Animal husbandry and ethics<\/p>\n
All experiments using mice were approved and performed in compliance with the Swiss Law on Animal Protection (Loi f\u00e9d\u00e9rale\u00a0sur la Protection des Animaux) under licence numbers GE45\/20 and GE81\/14. All animals were kept as a continuous backcross with C57BL6\u2009\u00d7\u2009CBA F1 hybrids. The mice were housed at the University of Geneva Sciences III animal colony, with light cycles between 07:00 and 19:00 in the summer and 06:00 and 18:00 in winter. Temperatures were maintained between 22\u2009\u00b0C and 23\u2009\u00b0C, with humidity levels between 45% and 55%. The air was renewed 17 times per hour. Zebrafish (Danio rerio) were maintained according to standard conditions53<\/a> under a 14\u2009h\/10\u2009h on\/off light cycle at 26\u2009\u00b0C, with set points of 7.5 and 600\u2009\u03bcS for pH and conductivity, respectively. All zebrafish husbandry procedures were approved and accredited either by the Federal Food Safety and Veterinary Office of the canton of Vaud, Switzerland (no. VD-H23), by the animal committees of Rutgers University under protocol no. 201702646 or under the guidance of the Institutional Animal Care and Use Committee (IACUC) of Boston Children\u2019s Hospital. AB, Tu and TL were used as wild-type strains and were obtained from the European Zebrafish Resource Center. The hoxdaDel(3DOM) and hoxdaDel(5DOM) mutants were generated for this study. Zebrafish embryos were derived from freely mating adults. Wild-type sibling hoxdaDel(3DOM) and hoxdaDel(5DOM) homozygous embryos were obtained by crossing the corresponding heterozygous mutant. Embryos were collected within 30\u2009min after spawning and incubated at 28.5\u2009\u00b0C in fish water, shifted to 20\u2009\u00b0C after reaching 80% epiboly and grown at 28.5\u2009\u00b0C to the proper developmental stage according to a previous study54<\/a>. Pigmentation was prevented by treating the embryos with 0.002% N-phenylthiourea from 1\u2009day post-fertilization (dpf) onwards. Sex was determined for animals used in the E18.5 UGS mouse experiments. Animals in other mouse experiments and in zebrafish experiments were not sexed. The sample size was not predetermined by a statistical test. Randomization and blinding were not conducted because the mutant and control animals were processed together in the same batch and grouped on the basis of their genotypes.<\/p>\n Generation of deletions in zebrafish<\/p>\n The hoxdaDel(3DOM) and hoxdaDel(5DOM) mutant alleles were generated using the CRISPR\u2013Cas9 system described in a previous study55<\/a>. The sequences of the CRISPR RNAs (crRNAs) used are listed in Supplementary Table\u20092<\/a>. Loci were identified using the GRCz11 zebrafish genome assembly available on Ensembl. The corresponding genomic regions were amplified and sequenced from fin clips. Adults carrying verified target sequences were isolated and then selected for breeding to generate eggs for genome editing experiments. The guide RNA target sites were determined using the open-source software CHOPCHOP (http:\/\/chopchop.cbu.uib.no\/index.php<\/a>). Chemically synthesized Alt-R crRNAs and Alt-R trans-activating CRISPR RNAs (tracrRNAs) and the Alt-R Cas9 protein were obtained from Integrated DNA Technologies (IDT). To test the efficiency of these guide RNAs in generating the expected mutant alleles, we injected boluses ranging from 100\u2009\u00b5m to 150\u2009\u00b5m and containing 5\u2009\u03bcM of the duplex crRNAs, tracrRNA and Cas9 ribonucleoprotein complex into the cytoplasm of one-cell-stage embryos. Injecting the ribonucleoprotein complex solution in a 100-\u00b5m bolus gave less than 5% mortality. With this condition, 30% of the embryos carried the 5DOM deletion and 15% carried the 3DOM deletion. For each condition, we extracted the genomic DNA of 20 individual larvae at 24\u2009hpf for genotyping56<\/a>. Identification of hoxdaDel(3DOM) and hoxdaDel(5DOM) mutants was performed using polymerase chain reaction (PCR). Amplification of evx2 was used as a control to confirm the presence or absence of 5DOM. The PCR mix was prepared using Phusion High-Fidelity DNA Polymerase (New England Biolabs), and primer sequences are listed in Supplementary Table\u20092<\/a>. In parallel, 120 larvae per allele were raised to adulthood. To identify founders, F0 adults were outcrossed with wild type and 25 embryos were genotyped. Three and four independent founders were obtained for the hoxdaDel(5DOM) allele and hoxdaDel(3DOM), respectively. Two founders of each deletion were verified by Sanger sequencing (Supplementary Data\u20091<\/a>) and used for further experiments.<\/p>\n Generation of knock-in reporter line<\/p>\n The endogenous hoxd13a reporter line (hoxd13aTg(hsp70:tdTomato)) was produced using a CRISPR\u2013Cas9-mediated Gbait vector knock-in approach57<\/a>,58<\/a>. A guide targeting the coding region of exon 1 of hoxd13a (hoxd13a_KI_crRNA) was co-injected with a Gbait vector targeting guide (GFP_crRNA) and Gbait:hsp70l:tdTomato plasmid17<\/a>. The injected embryos were screened for endogenous reporter RFP signal in expected hoxd13a expression domains, and positive individuals were raised to adulthood to outcross and recover F1 germline founders. To verify vector insertion and orientation in founders, genomic primers (hoxd13a_KI_F and hoxd13a_KI_R) were each paired with primers internal to the insert (LacZ_F and hsp70_R) for PCR and Sanger sequencing. The vector was oriented in the reverse direction relative to the endogenous promoter in the hoxd13aTg(hsp70:tdTomato) line, but reporter expression matched previously published in situ hybridization data and an hoxd13a knock-in line (hoxd13aegfp) generated independently by another research group59<\/a>. Genotyping primers are listed in Supplementary Table\u20092<\/a>.<\/p>\n Removal of CsB in cis to hoxd13a To delete the CsB sequence from the chromosome carrying the hoxd13aTg(hsp70:tdTomato) endogenous reporter, each individual crRNA was duplexed with tracrRNA and injected at a final concentration of 6.25\u2009\u03bcM with 1\u2009\u03bcg Alt-R S.p. Cas9 Nuclease V3 (IDT). To estimate guide efficiency, DNA was extracted from four pools of three embryos each from 12 injected embryos and 12 control siblings and analysed using the T7 endonuclease 1 mismatch detection assay60<\/a>. Embryos injected with efficient guides were raised to adulthood to outcross and identify founders. Guides flanking the CsB region (CsB_g1_crRNA and CsB_g2_crRNA) were injected into the hoxd13aTg(hsp70:tdTomato) background. The injected embryos were sorted by RFP signal at 1\u2009dpf, and 16 positive animals from each clutch were screened for CsB removal using PCR with deletion-spanning primers (CsB_g1_F and CsB_g2_R) that did not amplify the intact locus under short elongation conditions. Clutches exhibiting a high frequency of CsB removal were raised to adulthood, and individuals were outcrossed to T5D wild type to obtain embryos carrying hoxd13aTg(hsp70:tdTomato)-Del(CsB) chromosomes. To identify CsB deletions in cis to the reporter, outcrossed embryos were sorted for RFP and then genotyped for the CsB deletion. One F0 injected parent (purple male 3) produced gametes with hoxd13aTg(hsp70:tdTomato)-Del(CsB) chromosomes at high frequency (approximately 25%), as well as gametes in which the CsB in cis to the reporter was left intact. Sanger sequencing of the deletion-spanning PCR product from 16 embryos revealed that each hoxd13aTg(hsp70:tdTomato)-Del(CsB) chromosome carried an identical deletion, suggesting clonality. Embryos resulting from outcrosses of this injected individual (purple male 3) were used in a subsequent expression analysis. The sequences of the crRNAs and genotyping primers used are listed in Supplementary Table\u20092<\/a>. Sanger sequences of zebrafish founders are listed in Supplementary Data\u20091<\/a>.<\/p>\n Quantification of hoxd13a Outcrossed progeny with RFP signal from the endogenous reporter were collected at the 19-somite stage and at 72\u2009hpf. Embryos were fixed in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) (pH\u20097.4) for 2\u2009h at room temperature with agitation in light-blocking containers, rinsed two times for 10\u2009min each in PBS with 0.01% Tween 20 (PBST) and then incubated overnight at 4\u2009\u00b0C in PBST with DAPI. The next day, the embryos were washed twice for 30\u2009min each with PBST and processed for genotyping, as described above for the analysis of cloacal morphology of hox13 mutants, except that the head was removed for DNA extraction and the fins and trunk were retained for analysis. The embryos were imaged on a Zeiss LSM 800 confocal microscope to analyse hoxd13aTg(hsp70:tdTomato) expression. The laser and filter settings were optimized individually for each stage and tissue type to be compared, and then these settings were kept constant across CsB-intact and CsB-deleted individuals. For the 19-somite stage, the cloaca and tailbud were imaged simultaneously as a single piece of trunk, but for the 72-hpf animals, the fins, cloaca and tail were dissected and imaged separately. Maximum projection images were produced from each scan and then exported as TIF files for analysis in ImageJ61<\/a>. Each image was cropped to a specific region of interest (ROI) containing the specific expression domain, and ImageJ was used to measure the mean grey value for pixels in the region. The ROI size for each tissue was as follows: 75\u2009\u03bcm\u2009\u00d7\u200975\u2009\u03bcm for cloaca (19-somite and 72\u2009hpf), 250\u2009\u03bcm\u2009\u00d7\u2009250\u2009\u03bcm for 19-somite tailbud, 200\u2009\u03bcm\u2009\u00d7\u2009200\u2009\u03bcm for 72-hpf tails and 100\u2009\u03bcm\u2009\u00d7\u2009250\u2009\u03bcm for 72-hpf pectoral fins. For each tissue, the average mean grey value was calculated from CsB-intact individuals and used to normalize signal intensity values so that the average CsB-intact intensity for each tissue was equal to 1. The average relative intensities for CsB-intact and CsB-deleted tissues were compared using Welch\u2019s t-test in R (ref.\u200962<\/a>).<\/p>\n Zebrafish hox13 mutant lines<\/p>\n Frameshift loss-of-function alleles hoxa13ach307, hoxa13bch308 and hoxd13a5bpins were previously generated11<\/a>. The zebrafish lines were propagated and maintained, as described in a previous study63<\/a>. To generate compound hox13 mutants, animals that were triple heterozygous for hoxa13a, hoxa13b and hoxd13a were intercrossed. The resulting larvae were fixed at 6\u2009dpf in 4% PFA in PBS for 2\u2009h at room temperature, with rocking agitation. After fixation, the larvae were rinsed twice for 5\u2009min each in PBS with added 1% Triton X-100 (PBSX). To visualize the cloacal anatomy by labelling filamentous actin, the larvae were then incubated in PBSX with fluorophore-conjugated phalloidin (Sigma-Aldrich P1951; phalloidin-tetramethylrhodamine B isothiocyanate) added to a final concentration of 5\u2009U\u2009ml\u22121 overnight at 4\u2009\u00b0C, with rocking agitation. The larvae were then rinsed twice with PBSX for 1\u2009h each.<\/p>\n For genotyping, the phalloidin-labelled larvae were cut in half, separating the head, yolk and pectoral fins from the cloaca and tail. The head half was used for genotyping, and the tail half was stored at 4\u2009\u00b0C for later analysis. DNA was extracted from the head half by digesting tissue in proteinase K diluted to 1\u2009mg\u2009ml\u22121 in 20\u2009\u03bcl of 1\u00d7 PCR buffer (10\u2009mM Tris-HCl, 50\u2009mM KCl and 1.5\u2009mM MgCl2) for 1\u2009h at 55\u2009\u00b0C, followed by heat inactivation at 80\u2009\u00b0C for 20\u2009min. The digested tissue was then subjected to brief vortexing, and then 1\u2009\u03bcl was used directly as template for genotyping PCR, with primers listed in Supplementary Table\u20092<\/a>. For thermocycling, after an initial step at 94\u2009\u00b0C for 2\u2009min, reactions were cycled 40 times (15\u2009s at 94\u2009\u00b0C, 15\u2009s at 58\u2009\u00b0C and 20\u2009s at 72\u2009\u00b0C) and finished with 5\u2009min at 72\u2009\u00b0C. The PCR products were then heteroduplexed on a thermocycler by heating to 95\u2009\u00b0C for 10\u2009min and then gradually cooled by 1\u2009\u00b0C every 10\u2009s until a final temperature of 4\u2009\u00b0C was reached. Heteroduplexed PCR amplicons were then run on a high-percentage agarose gel to determine the genotype by product size.<\/p>\n To analyse cloacal morphology, fixed phalloidin-labelled tails were imaged using a Zeiss LSM 800 confocal microscope. After acquiring a full confocal stack through the cloacal region, a midline frame that demonstrated the hindgut and pronephric duct morphology was selected. In a separate set of quantifications, juveniles were photographed using a Leica M205 FCA stereotype microscope, PLANAPO 1.0\u00d7 zoom lens and Leica MC170 HD camera. Using the pencil tool in Illustrator, we traced the internal lumen of the hindgut and pronephric duct complex from the level of the proximal end of the median fin fold to the terminal exit. A perpendicular line was then drawn to measure the width of the complex. The lengths of these lines were measured using Illustrator and were used for statistical analysis.<\/p>\n Mutant mouse stocks<\/p>\n The following mouse lines used in this study were previously reported: Inv(Itga6-nsi)d11lac31<\/a>, Inv(Itga6\u2013attP) and tgBAC(HoxD)30<\/a>, Del(HoxD)32<\/a> and Del(Atf2\u2013SB1), Del(SB1\u2013Rel5) and Del(Rel5\u2013Rel1)2<\/a>.<\/p>\n Whole-mount in situ hybridization<\/p>\n The zebrafish and mouse antisense probes used in this study are listed in Supplementary Data\u20092<\/a> and 3<\/a>, respectively. For zebrafish, WISH was performed, as described56<\/a>, at 58\u2009\u00b0C for all riboprobes (hybridization temperature and saline\u2013sodium citrate washes). Whole-mount embryos were photographed using a compound microscope (SZX10; Olympus) equipped with a Nomarski optics and a digital camera (DP22; Olympus). Genotyping of individual embryos was performed after photographic documentation using the primers listed in Supplementary Table\u20092<\/a>. Wild-type and mutant embryos originated from the same clutch of eggs produced by heterozygote crosses and underwent WISH in the same well. Details on the number of embryos per experiment and genotype are provided in Supplementary Table\u20093<\/a>. Murine urogenital systems were isolated from E18.5 embryos and processed following a previously reported WISH procedure64<\/a>, with some specific adjustments. For proteinase K treatment, urogenital systems were incubated for 20\u2009min in proteinase K diluted to 20\u2009\u00b5g\u2009ml\u22121 in PBST. For the refixation step, a solution of 4% PFA containing 0.2% glutaraldehyde was used. The hybridization temperature was 69\u2009\u00b0C, and the temperature of the post-hybridization washes was 65\u2009\u00b0C. Staining was performed using BM-Purple (Roche; 11442074001) for approximately 4\u2009h at room temperature.<\/p>\n Hybridization chain reaction<\/p>\n HCR in situ hybridization was performed, as previously described65<\/a>, with slight modifications. Embryos were fixed in 4% PFA in PBS at 4\u2009\u00b0C overnight with rocking, washed three times for 5\u2009min in PBS with 0.1% Tween (PBST) and then dehydrated in methanol washes (25%, 50% and 75% in PBST) for 3\u2009min each, followed by five 10-min washes and one 50-min wash in 100% methanol. The embryos were stored at \u221220\u2009\u00b0C in methanol for at least 48\u2009h before starting the hybridization protocol. The embryos were rehydrated in methanol (75%, 50% and 25% methanol in PBST), washed twice with PBST and pre-hybridized in hybridization buffer (Molecular Instruments) at 37\u2009\u00b0C for at least 1\u2009h. The embryos were then incubated in 200\u2009\u03bcl of a hybridization solution with hoxd13a probes (IDT oPools; Supplementary Table\u20094<\/a>) at a concentration of approximately 65\u2009nM each overnight at 37\u2009\u00b0C. After 18\u201324\u2009h in probe solution, the embryos were washed four times for 15\u2009min each using a probe wash buffer (Molecular Instruments) at 37\u2009\u00b0C. The embryos were then washed twice for 5\u2009min each at room temperature with 5\u00d7 SCCT on a rocker before incubation in amplification buffer (Molecular Instruments) for at least 1\u2009h. The amplification solution with B2 546 amplifiers (Molecular Instruments) was prepared by heating 3\u2009\u03bcl of hairpin 1 (3\u2009\u03bcM) and 3\u2009\u03bcl of hairpin 2 (3\u2009\u03bcM) to 95\u2009\u00b0C for 90\u2009s, followed by snap-cooling. After 30\u2009min, hairpins 1 and 2 were mixed and added to 200\u2009\u03bcl of amplification buffer. The embryos were incubated in amplification solution overnight at room temperature on a rocker. After 18\u201324\u2009h of incubation in amplification solution, the embryos were washed at least four times for 30\u2009min each with 5\u00d7 SCCT at room temperature on a rocker. The embryos were stored at 4\u2009\u00b0C in 5\u00d7 SCCT for 1\u2009day until they were genotyped and mounted for confocal microscopy. Before genotyping, the embryos were washed in PBST with DAPI for 1\u2009h. DNA was extracted from the dissected head of each embryo. The pectoral fins were then microdissected using tungsten needles and mounted in PBST for confocal imaging using an inverted Zeiss LSM 800. Wild-type fins were used to optimize the laser and filter settings, which were maintained across all samples during data collection. After image acquisition, post-processing was performed on the maximum-intensity projections of each sample to reduce non-specific background signals. Specifically, the black value was changed from 0 to 50 uniformly for each image using the Zeiss Zen imaging software. These scans were then exported as TIF files for analysis in ImageJ61<\/a>. The images were cropped to an ROI of 180\u2009\u03bcm\u2009\u00d7\u2009120\u2009\u03bcm in size containing the hoxd13a fin expression domain. ImageJ was used to measure the mean grey value of ROI from each fin, and the average mean grey value was calculated from the wild-type fins. This average was used to normalize the signal intensity values such that wild-type fins had an average value of 1. The normalized relative intensities of wild-type and 5DOM deletion mutant fins were then compared using Welch\u2019s t-test in R62<\/a>.<\/p>\n Mouse genotyping<\/p>\n For extemporaneous genotyping, yolk sacs were collected and placed into 1.5-ml tubes containing rapid digestion buffer (10\u2009mM EDTA (pH\u20098.0) and 0.1\u2009mM NaOH) and then placed in a thermomixer at 95\u2009\u00b0C for 10\u2009min with shaking at 900\u2009rpm. While the yolk sacs were incubating, the PCR master mix was prepared using Z-Taq (Takara; R006B) and primers (Supplementary Table\u20092<\/a>) and aliquoted into PCR tubes. The tubes containing lysed yolk sacs were then placed on ice to cool briefly and quickly centrifuged at a high speed. The lysate (1\u2009\u03bcl) was placed in the reaction tubes and cycled 32 times (2\u2009s at 98\u2009\u00b0C, 2\u2009s at 55\u2009\u00b0C and 15\u2009s at 72\u2009\u00b0C). The PCR reaction (20\u2009\u03bcl) was loaded onto a 1.5% agarose gel, and electrophoresis was run at 120\u2009V for 10\u2009min. When samples could be kept for some time, a conventional genotyping protocol was applied using tail digestion buffer (10\u2009mM Tris (pH\u20098.0), 25\u2009mM EDTA (pH\u20098.0), 100\u2009mM NaCl and 0.5% SDS) added to each yolk sac or tail clipping at 250\u2009\u03bcl along with 4\u2009\u03bcl of proteinase K at 20\u2009mg\u2009ml\u22121 (Eurobio; GEXPRK01-15) and incubated overnight at 55\u2009\u00b0C. The samples were incubated at 95\u2009\u00b0C for 15\u2009min to inactivate the proteinase K and stored at \u221220\u2009\u00b0C until ready for genotyping. Genotyping primers (Supplementary Table\u20092<\/a>) were combined with Taq polymerase (ProSpec; ENZ-308) in 25-\u03bcl reactions, cycled twice with Ta\u2009=\u200964\u2009\u00b0C and then cycled 32 times with Ta\u2009=\u200962\u2009\u00b0C.<\/p>\n Mouse RT\u2013qPCR<\/p>\n UGSs were collected from E18.5 male embryos separately and placed in 1\u00d7 diethyl pyrocarbonate\u2013PBS on ice. A small portion of the remaining embryo was collected for genotyping. The UGSs were transferred into fresh 1\u00d7 diethyl pyrocarbonate\u2013PBS and then placed into RNAlater (Thermo Fisher Scientific; AM7020) for storage at \u221280\u2009\u00b0C until processing. Batches of samples were processed in parallel to collect RNA using RNeasy extraction kits (QIAGEN; 74034). After isolating total RNA, first-strand complementary DNA (cDNA) was produced with SuperScript III VILO (Thermo Fisher Scientific; 11754-050) using approximately 500\u2009ng of total RNA input. The cDNA was amplified with Promega GoTaq 2X SYBR Mix and quantified on a Bio-Rad CFX96 Real-Time System.\u00a0Expression levels were determined by the difference between the cycle threshold (Ct) of the gene of interest (GOI) and the reference gene Tbp, calculated as dCt = Ct(GOI) \u2212 Ct(Tbp). They were normalized to 1 for each condition by subtracting each dCT from the mean dCT for each wild-type set. Finally, expression was evaluated by the power\u00a02 minus this normalized dCT. Supplementary Table\u20092<\/a> contains the primer sequences used for quantification. RT\u2013qPCR measurements were taken from distinct embryos. Box plots for expression changes and two-tailed unequal variance t-tests were produced in DataGraph 4.6.1. The boxes represent the IQR, with the lower and upper hinges denoting the first and third quartiles (25th and 75th percentiles). Whiskers extend from the hinges to the furthest data points within 1.5 times the IQR. The upper whisker reaches the largest value within this range, whereas the lower whisker extends to the smallest value within 1.5 times the IQR from the hinge.<\/p>\n Mouse RNA-seq<\/p>\n E18.5 male and female UGSs were collected by means of dissection separating the bladder from the UGS, including the proximal urethra in males and the vagina in females. Tissues were stored in RNAlater (Thermo Fisher Scientific; AM7020) and processed in parallel using RNeasy extraction kits (QIAGEN; 74034). RNA quality was assessed using an Agilent Bioanalyzer 2100 with RNA integrity number scores greater than 9.5. RNA sequencing libraries were prepared at the University of Geneva Genomics Platform using Illumina TruSeq Stranded Total RNA with Ribo-Zero Gold Ribo-deleted RNA kits to produce strand-specific 100-bp single-end reads on an Illumina HiSeq 2000. Raw RNA-seq reads were processed with Cutadapt v.4.1 (-a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -q 30 -m 15)66<\/a> to remove TruSeq adapters and bad-quality bases. Filtered reads were mapped to the mouse genome mm39 using STAR v.2.7.10a67<\/a> using ENCODE parameters with a custom gtf file68<\/a> on the basis of Ensembl version 108. This custom GTF file was obtained by removing readthrough transcripts and all non-coding transcripts from a protein-coding gene. Fragments per kilobase of transcript per million mapped read values were evaluated using Cufflinks v.2.2.1 (refs.\u200969<\/a>,70<\/a>) with the options –max-bundle-length 10000000 –multiread-correct –library-type \u2018fr-firststrand\u2019 -b mm10.fa –no-effective-length-correction -M MTmouse.gtf -G. Box plots depicting expression levels in distinct embryos were generated using the same methodology as that used for RT\u2013qPCR.<\/p>\n ATAC-seq<\/p>\n Mouse and fish tissues were isolated and placed into 1\u00d7 PBS containing 10% fetal calf serum on ice. Collagenase (Sigma-Aldrich; C9697) was added to 50\u2009\u03bcg\u2009ml\u22121 and incubated at 37\u2009\u00b0C for 20\u2009min with shaking at 900\u2009rpm. Cells were washed three times in 1\u00d7 PBS. The number of cells was counted, and viability was confirmed to be greater than 90%. An input of 50,000 cells was processed according to a previous description36<\/a>. Sequencing was performed on \u00c9cole Polytechnique F\u00e9d\u00e9rale de Lausanne (EPFL) Gene Expression Core Facility (GECF) using an Illumina NextSeq 500. We analysed in a manner similar to a previous study71<\/a>. Raw ATAC-seq paired-end reads were processed with Cutadapt v.4.1 (-a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -A CTGTCTCTTATACACATCTGACGCTGCCGACGA -q 30 -m 15)66<\/a> to remove Nextera adapters and bad-quality bases. Filtered reads were mapped on mm39 for mouse samples and danRer11 in which alternative contigs were removed for fish samples using Bowtie 2 v.2.4.5 (ref.\u200972<\/a>) with the following parameters: –very-sensitive –no-unal –no-mixed –no-discordant –dovetail -X 1000. Only pairs mapping concordantly outside of mitochondria were kept (Samtools v.1.16.1) (ref.\u200973<\/a>). The PCR duplicates were removed using Picard v.3.0.0 (http:\/\/broadinstitute.github.io\/picard\/index.html<\/a>). The BAM files were converted to BED using bedtools v.2.30.0 (ref.\u200974<\/a>). Peaks were called, and coverage was generated by MACS2 v.2.2.7.1 with –nomodel –keep-dup all –shift -100 –extsize 200 –call-summits -B. Coverages were normalized to million mapped reads.<\/p>\n ChIP\u2013seq<\/p>\n Male UGSs were isolated and placed into 1\u00d7 PBS containing 10% fetal calf serum on ice. ChIP\u2013seq experiments were performed, as previously described75<\/a>. Briefly, they were fixed for 10\u2009min in 1% formaldehyde at room temperature, and the crosslinking reaction was quenched with glycine. Subsequently, nuclei were extracted, and chromatin was sheared using a water-bath sonicator (Covaris E220evolution ultrasonicator). Immunoprecipitation was performed using the following anti-H3K27ac (Abcam; ab4729) or anti-H3K27me3 (Merck Millipore; 07\u2013449). Libraries were prepared using the TruSeq protocol and sequenced on an Illumina HiSeq 4000 (100-bp single-end reads) according to the manufacturer\u2019s instructions. CTCF was reanalysed using datasets from previous studies43<\/a>,71<\/a>. The accession numbers are listed in Supplementary Table\u20095<\/a>. Raw ChIP\u2013seq single-end or paired-end reads were processed using Cutadapt v.4.1 (-a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC for single-end reads and -a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -A CTGTCTCTTATACACATCTGACGCTGCCGACGA -q 30 -m 15)66<\/a> to remove TruSeq or Nextera adapters and bad-quality bases. Filtered reads were mapped on mm39 for mouse samples and danRer11 in which alternative contigs were removed for reanalysis of fish samples using Bowtie 2 v.2.4.5 (ref.\u200972<\/a>) with the default parameters. Only alignments with a mapping quality above 30 were kept (Samtools v.1.16.1)73<\/a>. Peaks were called, and coverage was generated by MACS2 v.2.2.7.1 with –call-summits -B (and –nomodel –extsize 200 for single-end reads). Coverages were normalized to million mapped reads\/pairs.<\/p>\n Mouse enhancer\u2013reporter assay<\/p>\n Transgenic embryos were generated, as described33<\/a>. Primers were designed to amplify genomic DNA from the region around the observed ATAC and H3K27Ac peaks (Supplementary Table\u20095<\/a>). These primers included extra restriction sites for either XhoI or SalI at the 5\u2032 ends. The PCR fragments were cleaned using a QIAGEN Gel Extraction Kit (28704). The PCR fragment and the pSKlacZ reporter construct (GenBank X52326.1<\/a>)75<\/a> were digested with XhoI or SalI and ligated together using the Promega 2X Rapid Ligation kit (C6711). Sanger sequencing confirmed that the correct sequences were inserted upstream of the promoter. Maxipreps of the plasmid were prepared and eluted in 1\u00d7 IDTE (11-05-01-13). Pro-nuclear injections were performed, and embryos were collected at approximately E18.5 and stained for lacZ. UGSs were collected from E18.5 embryos in ice-cold 1\u00d7 PBS in a 12-well plate. All steps were performed with gentle shaking on a rocker plate at room temperature. Tissues were fixed for 5\u2009min at room temperature in freshly prepared 4% PFA. After fixing, the tissues were washed three times in 2\u2009mM MgCl2, 0.01% sodium deoxycholate, 0.02% Nonidet P-40 and 1\u00d7 PBS for 20\u2009min at room temperature. The wash solution was replaced with \u03b2-galactosidase staining solution (5\u2009mM potassium ferricyanide, 5\u2009mM potassium ferrocyanide, 2\u2009mM MgCl2 hexahydrate, 0.01% sodium deoxycholate, 0.02% Nonidet P-40, 1\u2009mg\u2009ml\u22121 of \u03b2-galactosidase and 1\u00d7 PBS) for overnight incubation with the plate wrapped in aluminium foil to protect from light. The tissues were then washed three times in 1\u00d7 PBS and fixed in 4% PFA for long-term storage. Images of embryos were collected using an Olympus DP74 camera mounted on an Olympus MVX10 microscope using Olympus cellSens Standard 2.1 software.<\/p>\n Mouse capture Hi-C sequencing<\/p>\n E18.5 male UGSs were collected, and collagenase-treated samples were crosslinked with 1% formaldehyde (Thermo Fisher Scientific; 28908) for 10\u2009min at room temperature and stored at \u221280\u2009\u00b0C until further processing, as previously described76<\/a>. The SureSelectXT RNA probe design used for capturing DNA was performed using the SureDesign online tool by Agilent. Probes cover the region chr.\u20092: 72240000\u201376840000 (mm9) producing twice the coverage, with moderately stringent masking and balanced boosting. DNA fragments were sequenced on an Illumina HiSeq 4000 and processed with HiCUP v.0.9.2 on mm39 with –re1 ^GATC77<\/a>, Bowtie 2 v.2.4.5 (ref.\u200972<\/a>) and Samtools v.1.16.1 (ref.\u200973<\/a>). The output BAM was converted to a pre-juicer medium format with hic2juicer from HiCUP. The pairs with both mates on chr.\u20092: 72233000\u201376832000 were selected, sorted and loaded into a 10-kb bin matrix with cooler v.0.8.11 (ref.\u200978<\/a>). The final matrix was balanced with the option –cis-only. TADs were computed using HiCExplorer hicFindTADs v.3.7.2 (refs.\u200979<\/a>,80<\/a>) with –correctForMultipleTesting fdr –minDepth 120000 –maxDepth 240000 –step 240000 –minBoundaryDistance 250000. Data were plotted on mm39 (chr.\u20092: 73600000\u201375550000).<\/p>\n Zebrafish Hi-C sequencing<\/p>\n The HiC profiles were derived from a reanalysis of data from previous studies43<\/a>,81<\/a>. The accession numbers are listed in Supplementary Table\u20095<\/a>. Reads were mapped on danRer11 in which alternative contigs were removed, and no selection of reads were performed. Valid pairs were loaded into a 10-kb bins matrix. TAD calling parameters were adapted to the smaller size of the genome: –chromosomes “chr9” –correctForMultipleTesting fdr –minDepth 35000 –maxDepth 70000 –step 70000 –minBoundaryDistance 50000. Data were plotted on danRer11 (chr.\u20099: 1650000\u20132400000) and on an inverted x axis.<\/p>\n CUT&RUN<\/p>\n Zebrafish samples were processed using a final concentration of 0.02% digitonin (Apollo; APOBID3301). Approximately 0.5\u2009\u00d7\u2009106 cells were incubated with 0.1\u2009\u03bcg\u2009(100\u2009\u03bcl)\u22121 of anti-H3K27ac antibody (Abcam; Ab4729) or 0.5\u2009\u03bcg\u2009(100\u2009\u03bcl)\u22121 of anti-H3K27me3 (Merck Millipore; 07-449) in digitonin wash buffer at 4\u2009\u00b0C. The protein A\u2013micrococcal nuclease was kindly provided by the Henikoff Lab (batch 6) and added at 0.5\u2009\u03bcl\u2009(100\u2009\u03bcl)\u22121 in digitonin wash buffer. Cells were digested in high-calcium buffer and released for 30\u2009min at 37\u2009\u00b0C. Sequencing libraries were prepared with KAPA HyperPrep reagents (07962347001) with 2.5\u2009\u03bcl of adapters at 0.3\u2009\u03bcM and ligated for 1\u2009h at 20\u2009\u00b0C. The DNA was amplified for 14 cycles. Post-amplified DNA was cleaned and size selected using 1:1 ratio of DNA:AMPure SPRI beads (A63881) followed by an extra 1:1 wash and size selection with HXB. HXB is equal parts 40% polyethylene glycol 8,000 (Thermo Fisher Scientific; FIBBP233) and 5\u2009M NaCl. Sequencing was performed at EPFL GECF on an Illumina HiSeq 4000. Raw CUT&RUN paired-end reads were processed with Cutadapt v.4.1 (-a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -q 30 -m 15) to remove TruSeq adapters and bad-quality bases66<\/a>. Filtered reads were mapped on danRer11, in which alternative contigs were removed with Bowtie 2 v.2.4.5 (ref.\u200972<\/a>) with the following parameters: –very-sensitive –no-unal –no-mixed –no-discordant –dovetail -X 1000. Only alignments with mapping quality above 30 were kept (Samtools v1.16.1) (ref.\u200973<\/a>). PCR duplicates were removed by Picard v.3.0.0 (http:\/\/broadinstitute.github.io\/picard\/index.html<\/a>). BAM files were converted to BED with bedtools v.2.30.0 (ref.\u200974<\/a>). Peaks were called, and coverage was generated by MACS2 v.2.2.7.1 with –nomodel –keep-dup all –shift -100 –extsize 200 –call-summits -B. Coverages were normalized to million mapped reads.<\/p>\n Analyses of conserved sequences<\/p>\n Annotation of orthologous domains was performed using transcription start sites of orthologous genes, as reported in Supplementary Table\u20096<\/a>. To identify conserved sequences between mouse and zebrafish, a pairwise alignment was done between the mouse genomic region chr.\u20092: 73600000\u201375550000 (mm39) and the zebrafish orthologous region chr.\u20099: 1650000\u20132400000 (danRer11) using discontinuous megablast. To reduce false positives, only reciprocal hits were considered. To display multispecies conservation levels, multiple alignment format files were generated between chr.\u20092 of the mouse genome (mm39) and contig chrUn_DS181389v1 of the platypus genome (ornAna2), chr.\u20097 of the chicken genome (galGal6), contig chrUn_GL343356 of the lizard genome (anoCar2), chr.\u20099 of the frog genome (xenTro10), contig JH127184 of the coelacanth genome (latCha1), chr.\u20099 of the zebrafish genome (danRer11), chr.\u20091 of the fugu genome (fr3) and the whole lamprey genome (petMar3). Details for the multiple alignment format generation are available on the GitHub repository (https:\/\/github.com\/AurelieHintermann\/HintermannBoltHawkinsEtAl2025<\/a>; ref.\u200982<\/a>). To facilitate visualization, a horizontal line was plotted for each species on each region.<\/p>\n Whole-genome alignments<\/p>\n Whole-genome alignments were performed using Progressive Cactus v.2.6.7 (ref.\u200983<\/a>). The cactus command was used with default parameters to obtain the hierarchical alignment format. The hierarchical alignment was then projected on either zebrafish chr.\u20099 or mouse chr.\u20092 with cactus-hal2maf84<\/a> using –chunkSize 500000 and –noAncestor. The genome assemblies are listed in Supplementary Table\u20096<\/a>.<\/p>\n Single-cell assay for transposase-accessible chromatin sequencing<\/p>\n The single-cell assay for transposase-accessible chromatin sequencing (scATAC-seq) bigwig files were downloaded from a previous study37<\/a> (Gene Expression Omnibus (GEO) GSE243256<\/a>) where annotations were available. To annotate the cells from the cloaca, the raw matrix of single-cell RNA sequencing (scRNA-seq) from a previous study38<\/a> was downloaded from GEO (GSE223922<\/a>) and stored in a Seurat object. Only 12,424 cells obtained at 14\u2009hpf were kept. The data were normalized, and 3,000 variable features were extracted. Data were scaled. Uniform manifold approximation and projection (UMAP) and t-distributed stochastic neighbour embedding projections were calculated using the first 50 principal components. In parallel, scATAC-seq fragments of cells corresponding to 14\u2009hpf were extracted from the general fragment file provided in a previous study38<\/a> on GEO (GSE243256<\/a>). A new ArchR gene annotation was generated using the Lawson gtf v.4.3.2 (ref.\u200985<\/a>) to match the scRNA-seq data from a previous study37<\/a>, and the selected fragments were loaded into an ArchRProject with this genome. Iterative latent semantic indexing was computed with COR-Cut-off of 0.5. The clustering of scRNA-seq was then transferred to scATAC-seq using AddGeneIntegrationMatrix. The profile of the 38 cells whose transferred cluster corresponds to cloaca (endo.31) was generated with getGroupBW.<\/p>\n scRNA-seq<\/p>\n The matrix of the scRNA-seq atlas was downloaded from GEO (GSE223922<\/a>; ref.\u200937<\/a>) and the table with metadata. The matrix was loaded into a Seurat object using Seurat v.4.3.0 (ref.\u200986<\/a>) in R v.4.3.0. Cells attributed to the \u2018tissue.name\u2019 \u2018endoderm\u2019 were selected. Normalization and principal component analysis were performed, as described in a previous study37<\/a>. UMAP was performed on the top 70 principal component analyses and 50 nearest neighbours. UMAP coordinates and hox13 normalized expression of endoderm cells were exported to a file and plotted using ggplot2 v.3.4.4.<\/p>\n Software<\/p>\n The phylogenic tree was generated with http:\/\/timetree.org<\/a> using the following species: Mus musculus, Protopterus, D.\u2009rerio, Carcharhinus leucas, Petromyzon marinus and Branchiostoma lanceolatum and subsequently edited using SeaView 4.7. Genomic tracks from next-generation sequencing were plotted using pyGenomeTracks 3.8 using custom gene annotations available at https:\/\/doi.org\/10.5281\/ZENODO.7510796<\/a> (ref.\u200968<\/a>; mm39) and https:\/\/doi.org\/10.5281\/zenodo.10283273<\/a> (ref.\u200987<\/a>; danRer11). RT\u2013qPCR, RNA-seq and domain size quantifications were plotted in R using the ggplot package.<\/p>\n Ethical statement<\/p>\n All experiments involving mice were performed in agreement with the Swiss Law on Animal Protection (Loi sur la Protection des Animaux) under licence no. GE 81\/14. For zebrafish, work was carried out either under a general licence of EPFL granted by the Service de la Consommation et des Affaires V\u00e9t\u00e9rinaires of the Canton of Vaud, Switzerland (no. VD-H23) or was either agreed upon by the animal committees of Rutgers University under protocol no. 201702646 or under guidance of the Institutional Animal Care and Use Committee of Boston Children\u2019s Hospital.<\/p>\n Reporting summary<\/p>\n
\n Tg(hsp70:tdTomato)<\/p>\n
\n Tg(hsp70:tdTomato) expression<\/p>\n