Cultivation<\/p>\n
Anaerobic cultivation techniques were applied18<\/a>. One liter of freshwater medium contained 1.0\u00a0g of NaCl, 0.4\u00a0g of MgCl2\u2009\u00d7\u20096 H2O, 0.1\u00a0g of CaCl2, 0.5\u00a0g of KCl, 0.2\u00a0g of KH2PO4, 0.25\u00a0g of NH4Cl, and 0.2\u00a0g of NaSO4 in pure water. After autoclaving, 1\u00a0ml of the following sterile solutions was added to 1\u00a0l of medium: chelated trace element mixture (per liter of distilled water: 2100\u00a0mg of FeSO4\u2009\u00d7\u20097 H2O, 60\u00a0mg of H3BO3, 1.0\u00a0g of MnCl2\u2009\u00d7\u20094 H2O, 0.38\u00a0g of CoCl2\u2009\u00d7\u20096 H2O, 0.24\u00a0g of NiCl2\u2009\u00d7\u20096 H2O, 2\u00a0mg of CuCl2\u2009\u00d7\u20092 H2O, 0.29\u00a0g of ZnSO4\u2009\u00d7\u20097 H2O, 72\u00a0mg of NaMoO4\u2009\u00d7\u20097 H2O, and 7.8\u00a0g of Na2EDTA, pH 6.0), selenite-tungstate solution (per liter: 0.4\u00a0g of NaOH, 32\u00a0mg of Na2WO4\u2009\u00d7\u20092 H2O, 24\u00a0mg of Na2MoO4\u2009\u00d7\u20092 H2O, and 6\u00a0mg of Na2SeO3\u2009\u00d7\u20095 H2O), vitamin solution (4\u00a0mg of 4-aminobenzoic acid, 2\u00a0mg of D-(+)-biotin, 10\u00a0mg of nicotinic acid, 5\u00a0mg of calcium D-(+)-pantothenate, 15\u00a0mg of pyridoxin hydrochloride, 4\u00a0mg of folic acid, and 1.5\u00a0mg of lipoic acid in 100\u00a0ml of 10 mM NaH2PO4, pH 7.1), cyanocobalamin solution (5 mg L\u2212\u20091), thiamine solution (10\u00a0mg of thiamine hydrochloride in 100\u00a0ml of 25 mM NaH2PO4, pH 3.4), and riboflavin solution (2.5\u00a0mg in 100\u00a0ml of 25 mM NaH2PO4, pH 3.2). After addition of sterile stock solutions\u2009\u2212\u20092 mL of 0.5\u00a0M cysteine, 2 mL of 1\u00a0M sodium acetate and 30 mL of 1\u00a0M NaHCO3 – the pH was adjusted to 7.0 with sterile 2.0\u00a0M HCl.<\/p>\n The methanogenic enrichment culture was maintained with an annual transfer of 10% (vol\/vol) inoculum. The cultures contained 300 mL freshwater medium, 0.3 mL of 200 mM FeS suspension, 30 mL 2,2,4,6,8,8-heptamethylnonane (HMN), and 1.5 mL of R-(+)-limonene under an oxygen-free N2\u2013CO2 atmosphere (90:10, vol\/vol, < 7 ppm O2) in 500-mL borosilicate bottles. Incubation occurred on an orbiting shaker with 60\u00a0rpm at 28 \u00b0C5<\/a>.<\/p>\n Cell separation and RNA extraction<\/p>\n Biomass was obtained by differential centrifugation. Large and aggregated cells were pelleted in a SW28 ultracentrifuge rotor (Beckman, Palo Alto, CA) at 7600\u00a0rpm (7643 g) for 20\u00a0min (10,000 Svedberg [S]). The 10 kS cell pellet was resuspended in 1 mL of\u00a010 mM Tris, 1 mM EDTA, pH 8.0 (TE). RNA was extracted using the RNA PowerSoil Total RNA Isolation Kit (Qiagen, Hilden, Germany). RNA sequencing was performed by the Max Planck-Genome-centre Cologne, Germany (https:\/\/mpgc.mpipz.mpg.de\/home\/<\/a>) using NEB Next Ultra RNA kit (New England Biolabs, Ipswich, MA) for the production of an Illumina-compatible library and Illumina HiSeq (Illumina, San Diego, CA) (150\u00a0bp reads; 57,878,109 reads revealing 8,918,223,863 bases were deposited at NCBI SRR30230645)6<\/a>.<\/p>\n In situ hybridization<\/p>\n Catalyzed reporter deposition-fluorescence in situ hybridization (CARD-FISH)19<\/a> was used targeting 16\u00a0S ribosomal RNA and intron RNA. Living Methanosaeta cells were identified with probe ARCH915 (GTGCTCCCCCGCCAATTCCT)20<\/a>. Ca. Velamenicoccus archaeovorus probe OP3-565 (TACCTGCCCTTTACACCC)21<\/a> was used together with manually designed partially degenerated helper oligonucleotides H548-A (AATAAATCCGAGTAACGC), H548-C (AATCAATCCGAGTAACGC), H583-TC (CTCCCCACTTGTCAGGCCGCC) and H583-CT (CCTCCCACTTGTCAGGCCGCC)5<\/a>. The group I intron in the 23\u00a0S rRNA was targeted within the gene for homing endonuclease. Probes and flanking helper oligonucleotides were designed using Primer3 v. 4.0.0 (http:\/\/sourceforge.net\/projects\/primer3\/<\/a>). Specificity was tested against the metagenome datasets of the enrichment culture6<\/a>. Probes were hen1-2235 (CCGCCAAGTAGTAGCCGATT), hen2-2309 (AACTTTCCACGGTGACTTGT), hen3-2538 (TCTTTATCATTTCTGCCAGTTCG) and the reverse complement hen2-rc2309 (ACAAGTCACCGTGGAAAGTT). Helper were Hhen1-2210 (TCTGGTTTCATAAAGACCTCCTTCT), Hhen1-2255 (TCCTTCTCCGTCGGCAAAAC), Hhen2-2288 (AGTCTTGCCGTTGTCTGAAGG), Hhen2-2329 (CTGGGAGATGTTGAAACAAAGAGA), Hhen3-2516 (CAGAATTTCGCAAAATCCCGTT), Hhen3-2561 (GCTACTCTTAAGATGTTCCCCCT). For intron detection, a formamide concentration of 20% was used at concentrations of 0.17 ng\/\u00b5l for each probe and helper. One mL of culture was fixed with formaldehyde (1.3% [wt\/vol]) for 60\u00a0min at 21\u00a0\u00b0C. Five \u00b5L of fixed culture were dried on a glass slide and then rinsed with 1\u00a0ml of phosphate buffered saline (PBS, pH 7.4). Cells were embedded in 0.1% [wt\/vol] low-melting agarose and air dried. Permeabilization was performed for 60\u00a0min at 37\u00a0\u00b0C by lysozyme (10\u00a0mg\/mL) and proteinase K (200\u00a0\u00b5g\/ml) for 2\u00a0min at 21\u00a0\u00b0C.\u00a0Washing steps were performed as described19<\/a>. Endogenous peroxidases were inactivated with 0.1\u00a0M HCl for 1\u00a0min at 21\u00a0\u00b0C, a washing with 1x PBS, and 3% H2O2 for 10\u00a0min at 21\u00a0\u00b0C. The probes were hybridized for 160\u00a0min at 46\u00a0\u00b0C, followed by incubation with Alexa448 or Alexa594-tyramide conjugates at 46\u00a0\u00b0C for 45\u00a0min in the dark. After DNA staining with 4\u2032,6-diamidino-2-phenylindole (DAPI, 1\u00a0\u00b5g\/mL), cell preparations were embedded in Citifluor-Vectashield antifading medium (4:1 [vol\/vol]). Images were obtained with an epifluorescence microscope (Zeiss Axiophot with camera MRm and HBO100 light source using Zeiss Axiovision). Confocal laser scanning microscopy (CLSM) and super resolution structured illumination microscopy (SR-SIM) were performed using a Zeiss LSM 780 equipped with a ELYRA PS.1 module. Zeiss Zen 3.11 was used to analyse the images (Zeiss, Oberkochen, Germany).<\/p>\n Sequence analysis<\/p>\n RNA reads (NCBI: SRR30230645) were trimmed with BBDuk to > Q30 and longer than 30 nt. Coverage of reads mapping with at least 99% identity was determined using BBMap and Ca. Velamenicoccus archaeovorus (NCBI CP019384) or partial sequences thereof (300 nt for exon\/intron border, intron sequence). Both calculations were performed within Geneious (Dotmatics, Boston, MA) with the default parameters within Geneious, except for the ones stated. Reads covering the borders between intron and exon were quantified by manual inspection of mapped and aligned reads (150\u00a0bp) to aforementioned partial sequences.<\/p>\n","protected":false},"excerpt":{"rendered":"Cultivation Anaerobic cultivation techniques were applied18. One liter of freshwater medium contained 1.0\u00a0g of NaCl, 0.4\u00a0g of MgCl2\u2009\u00d7\u20096…\n","protected":false},"author":2,"featured_media":437836,"comment_status":"","ping_status":"","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[7],"tags":[85,190909,2026,61,190908,60,2746,190910,12053,2027,82],"class_list":["post-437835","post","type-post","status-publish","format-standard","has-post-thumbnail","category-science","tag-evolution","tag-extracellular-rna","tag-humanities-and-social-sciences","tag-ie","tag-intron-group-i","tag-ireland","tag-microbiology","tag-mobile-genetic-element","tag-molecular-biology","tag-multidisciplinary","tag-science"],"_links":{"self":[{"href":"https:\/\/www.newsbeep.com\/ie\/wp-json\/wp\/v2\/posts\/437835","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/www.newsbeep.com\/ie\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/www.newsbeep.com\/ie\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/www.newsbeep.com\/ie\/wp-json\/wp\/v2\/users\/2"}],"replies":[{"embeddable":true,"href":"https:\/\/www.newsbeep.com\/ie\/wp-json\/wp\/v2\/comments?post=437835"}],"version-history":[{"count":0,"href":"https:\/\/www.newsbeep.com\/ie\/wp-json\/wp\/v2\/posts\/437835\/revisions"}],"wp:featuredmedia":[{"embeddable":true,"href":"https:\/\/www.newsbeep.com\/ie\/wp-json\/wp\/v2\/media\/437836"}],"wp:attachment":[{"href":"https:\/\/www.newsbeep.com\/ie\/wp-json\/wp\/v2\/media?parent=437835"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/www.newsbeep.com\/ie\/wp-json\/wp\/v2\/categories?post=437835"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/www.newsbeep.com\/ie\/wp-json\/wp\/v2\/tags?post=437835"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}