Protocols<\/p>\n
All experimental procedures involving mice were carried out in accordance with UK Home Office, Canadian Council on Animal Care, the Ethics Committee of the French Research Ministry (authorization number 00486.01), Belgian Law of May 29, 2013 regarding the protection of laboratory animals (agreement number LA1230314) and local guidelines on animal welfare and license conditions and the University of Oxford, University of Ottawa, Universit\u00e9 Pierre et Marie Curie and Universit\u00e9 catholique de Louvain guidelines on animal welfare.<\/p>\n
PBMC isolation and cell-based assays<\/p>\n
PBMCs were isolated by our established method73<\/a>, following local ethical approval from Imperial College Research Ethics Committee (19IC5372). Human peripheral blood samples (32\u2009ml) were collected from donors in BD Vacutainer Cell Preparation Tubes containing Sodium Heparin\/Ficoll (BD Biosciences). PBMCs were separated by centrifugation at 1600g for 30\u2009min at room temperature (20\u201322 \u00b0C), followed by three washing steps with PBS and 10% FBS (LabTech) and centrifuged at 520\u2009RCF for 10\u2009min after each wash. Viability was measured using the Alamar Blue assay. Donors were females, aged between 25 and 32\u2009years. All subjects were healthy volunteers by self-declaration and provided written informed consent.<\/p>\n LPS stimulation and IL-6 and TNF release quantification<\/p>\n Human PBMCs (1\u2009\u00d7\u2009105 per condition in duplicate), freshly isolated as described above, were serum-starved in 0.1% v\/v FCS RPMI-1640 (Sigma-Aldrich, R7638) in the presence of TMA (Sigma-Aldrich, 72761) or the IRAK4 inhibitor PF06650833 (0.5\u2009\u03bcM; Tocris, 6373) for 30\u2009min, as indicated in the corresponding figures. PBMCs were subsequently stimulated with 1\u2009\u03bcg\u2009ml\u22121 LPS (Sigma-Aldrich, L2630) for 4\u2009h (37\u2009\u00b0C, 5% CO2). For the phorbol 12-myristate 13-acetate (PMA)\/ionomycin stimulation experiments, human PBMCs isolated as above (1\u2009\u00d7\u2009105 per condition) pre-incubated with TMAO (100\u2009\u03bcM), PF06650833 (0.5\u2009\u03bcM) or vehicle as indicated for 30\u2009min were then stimulated with 50\u2009ng\u2009ml\u22121 PMA (Sigma-Aldrich, 79346) and 1\u2009\u03bcg\u2009ml\u22121 ionomycin (Sigma-Aldrich, I0634) for 4\u2009h. Next, cells were pelleted by centrifugation (200g for 10\u2009min), and supernatants were collected and stored at \u221220\u2009\u00b0C until further use. IL-6 and TNF were measured in the media diluted 1:10 in RPMI-1640 using the DuoSet ELISA kits (R&D, DY206 and DY210, respectively) according to the manufacturer\u2019s instructions. For PMA\/ionomycin TNF measurements, the media were undiluted. For all treatments, n\u2009=\u20094 biological repeats.<\/p>\n PBMCs IRAK1 and NF-\u03baBp65 phosphorylation in response to LPS<\/p>\n Freshly isolated human PBMCs (1\u2009\u00d7\u2009106 per ml per condition) were added to 96-well plates coated with L-poly-lysine for 30\u2009min (100\u2009ng\u2009ml\u22121; Sigma-Aldrich, P4707) in RPMI-1640 containing 20% FCS and were left to attach to the wells overnight at 37\u2009\u00b0C, 5% CO2. The following day, media were discarded and cells were incubated in serum-free RPMI-1640 containing 100\u2009\u03bcM TMA, or RPMI-1640 vehicle for 30\u2009min. PBMCs were then stimulated with LPS (1\u2009\u03bcg\u2009ml\u22121) for up to 60\u2009min (times indicated in the corresponding figure legends). At the end of the stimulation, PBMCs were fixed with 8% paraformaldehyde (Sigma-Aldrich, F8775) at room temperature for 20\u2009min. Phosphorylation of IRAK1 (at Thr209) or NF-\u03baBp65 (at Ser536) was determined in fixed PBMCs using commercially available ELISA kits (LSBio, LS-F1401-1 or LS-F891-1, respectively) according to the manufacturer\u2019s instructions. Readings were normalized to the levels of total IRAK1 protein determined in sister wells, which were treated identically. The dose-dependent impact of TMA (see corresponding figures) on phosphorylation levels of IRAK1 or NF-\u03baBp65 upon LPS (1\u2009\u00b5g\u2009ml\u22121) stimulation of PBMCs (for 10\u2009min or 15\u2009min, respectively) was also determined using the commercially available kits from LSBio as described above.<\/p>\n Cell-based assays in primary human hepatocytes<\/p>\n Cryopreserved primary human hepatocytes were commercially sourced (Innoprot) and cultured with hepatocytes medium (Innoprot) supplemented with 5% FBS, 1% hepatocytes growth supplement (mixture of growth factors, hormones and proteins necessary for culture of primary hepatocytes) and 100\u2009U\u2009ml\u22121 penicillin and streptomycin. Human hepatocytes were grown on poly-L-lysine pre-coated cell dishes at 37\u2009\u00b0C and a 5% CO2 atmosphere following the manufacturer\u2019s recommendations. The following experiments were performed 24\u2009h after seeding: first, palmitic acid (200\u2009\u03bcM) administration (0 and 60\u2009min) with or without TMA (0.1\u2009mM, 30\u2009min) pre-treatment, plus co-administration during palmitic acid exposure were assayed. The palmitic acid solution was prepared as previously reported44<\/a>,74<\/a>. In this experiment, the effect of palmitic acid and TMA on IRAK1, IRAK4, NF-\u03baBp65, IKK\u03b1\u03b2, SAPK\/JNK and p38MAPK activity was analysed. In a second experiment, the effect of TMA (0.1\u2009mM, 30\u2009min) pre-treatment plus co-administration during vehicle or palmitic acid exposure for 4\u2009h on insulin action and on IL-6 release was tested. Insulin action was evaluated by measuring pSer473Akt1\/Akt1 after insulin (100\u2009nM, 10\u2009min) stimuli.<\/p>\n pThr209IRAK1, total IRAK1, pSer536NF-\u03baBp65, total NF-\u03baBp65, pSer473AKT1, total AKT1 and GAPDH (as an endogenous control) were measured with specific colourimetric cell-based ELISA Kits (Assay Biotechnology Company, CytoGlow IRAK1 (CBP1425), CytoGlow NF-\u03baBp65 (CBP1633) and CytoGlow AKT1 (CBP1490), following the manufacturer\u2019s instructions. For data analysis, the optical density of target proteins (read at 450\u2009nm) was normalized with cell nuclei crystal violet staining (read at 595\u2009nm), which was proportional to cell counts. The analysis of cell-based assays was performed in a blind manner.<\/p>\n pThr345\/Ser346IRAK4\/IRAK4, pSer176\/180IKK\u03b1\u03b2\/IKK\u03b2, pThr183\/Tyr185SAPK\/JNK and pThr180\/Tyr182p38MAPK\/p38MAPK were determined by western blot. In brief, hepatocyte proteins were directly extracted in radioimmunoprecipitation assay (RIPA) buffer (0.1% SDS, 0.5% sodium deoxycholate, 1% Nonidet P-40, 150\u2009mM NaCl and 50\u2009mM Tris-HCl pH\u20098.0) supplemented with protease inhibitors (1\u2009mM phenylmethylsulfonyl fluoride). Cellular debris and lipids were eliminated by centrifugation of the solubilized samples at 13,000\u2009rpm for 10\u2009min at 4\u2009\u00b0C, recovering the soluble fraction. Protein concentration was determined using the RC\/DC Protein Assay (Bio-Rad Laboratories). RIPA protein extracts (20\u2009\u03bcg) were separated by SDS\u2013PAGE and transferred to nitrocellulose membranes by conventional procedures. Membranes were immunoblotted with antibodies against the following proteins: pThr345\/Ser346IRAK4 (11927), IRAK4 (4363), pSer176\/180IKK\u03b1\u03b2 (2694), IKK\u03b2 (8943), pThr183\/Tyr185SAPK\/JNK (4668), SAPK\/JNK (9258), pThr180\/Tyr182p38MAPK (9215) and p38MAPK (9212), all purchased from Cell Signaling Technology, and \u03b2-actin (sc-47778, Santa Cruz Biotechnology). Anti-rabbit IgG and anti-mouse IgG coupled to horseradish peroxidase was used as a secondary antibody. Horseradish peroxidase activity was detected by chemiluminescence, and quantification of protein expression was performed using Scion Image software. IL-6 concentration in hepatocyte media was measured using Human IL-6 Quantikine ELISA Kit (R&D Systems, D6050). All experiments were performed with at least three sample replicates.<\/p>\n Mouse modelsLongitudinal HFD feeding in mice<\/p>\n All experiments were approved by the ethical committee of the University of Oxford. Male mice from a C57BL\/6J inbred strain were bred in our animal facility by using a stock originating from The Jackson Laboratory. At 5\u2009weeks of age, groups of eight to ten mice were transferred to a 40% w\/w HFD (65% kcal) (Special Diets Services, 824155b), containing 32% lard and 8% corn oil, whereas control groups remained on a normal carbohydrate (CHD) diet containing 5% fat, 19% protein and 3.5% fibre (B&K rat and mouse pelleted diet, B&K Universal) for up to 6\u2009months. Detailed diet formulations were published previously13<\/a> and are summarized in Supplementary Table 6<\/a>.<\/p>\n Mice were housed under a 12\u2009h\u201312\u2009h light\u2013dark cycle. For physiological profiling, several mouse groups fed CHD or HFD were tested to assess the consistency of results and discard any impact of potential batch effects. Intraperitoneal GTTs were performed on 2, 3, 5 and 7-month-old mice after an overnight fast, as previously published75<\/a> (see also metabolic phenotyping below). Then, 4\u2009days after the GTT, 24\u2009h urinary samples (09:00\u201321:00\u2009h) were collected from mice maintained in individual metabolic cages. Urinary samples collected in a solution of 1% (wt\/vol) sodium azide were centrifuged to remove solid particles and kept at \u221280\u2009\u00b0C until assayed. After an overnight fast, mice were killed by exsanguination. Plasma was separated by centrifugation and stored at \u221280\u2009\u00b0C until 1H-NMR analysis.<\/p>\n Choline supplementation on HFD<\/p>\n At 5\u2009weeks of age, mice were fed either a CHD containing 2\u2009g of choline per kg of diet (Research Diets, D12450J), a LC-HFD containing 2\u2009g of choline per kg of diet (Research Diets, D12492), a HC-HFD containing 17\u2009g of choline per kg of diet (Research Diets, D16100401), a HC-HFD containing 1% of DMB or a HC-HFD combined with a cocktail of antibiotics (0.5\u2009g\u2009l\u22121 vancomycin hydrochloride, 1\u2009g\u2009l\u22121 neomycin trisulfate, 1\u2009g\u2009l\u22121 metronidazole, 1\u2009g\u2009l\u22121 ampicillin sodium) in drinking bottles (n\u2009=\u20096\u201310 per group) for 8\u2009weeks (see diet formulations in Supplementary Table 6<\/a>). Mice were then killed by decapitation, and organs were dissected and weighed.<\/p>\n Irak4 Irak4\u2212\/\u2212 mice on a C57BL\/6J background, as previously described38<\/a>,45<\/a>, were bred with C57BL\/6J mice (The Jackson Laboratory), and the F1 offspring were subsequently bred to produce the Irak4\u2212\/\u2212 mice and wild-type littermates used for this study. Mice were bred and genotyped at the Animal Facility of the University of Ottawa Heart Institute. The following primers were used for genotyping. Irak4 knockout, 5\u2032-TGAATGGAAGGATTGGAGCTACGGGGGT-3\u2032; Irak4 common, 5\u2032-GAACACGCTCCCAGGTCTCTTTCCAAC-3\u2032; and Irak4 wild-type, 5\u2032-TCTTCTACCTGAAATATGAAAGATTCCT-3\u2032. The PCR reaction was run at 94\u2009\u00b0C for 60\u2009s, 60\u2009\u00b0C for 60\u2009s and 72\u2009\u00b0C for 60\u2009s for 40 cycles. The mice (10\u201312\u2009weeks old) were fed with HFD for 8\u2009weeks and then killed by decapitation, and their organs were dissected and weighed at the end of the study.<\/p>\n Chronic TMA and PF06650833 treatment in LC-HFD-fed mice<\/p>\n C57BL\/6J mice (Charles River; 5\u2009weeks old) were housed for 1\u2009week before the experiment in a controlled environment. Mice were maintained under a 12 h\u201312\u2009h light\u2013dark cycle. On day\u20090, the 10-week-old mice were anaesthetized with isoflurane (ForeneH, Abbott). Mini-osmotic pumps were implanted subcutaneously (Model 2006, Alzet) (flow rate, 0.15\u2009ml\u2009h\u22121; total filling volume, 200\u2009ml; delivery duration, 42\u2009days) as previously described76<\/a>. The osmotic mini-pump contained either vehicle or TMA (0.1\u2009mM in circulation) or PF06650833 (50\u2009nM in circulation). After 6\u2009weeks of metabolite treatment, mice were killed by decapitation, and the organs were dissected and weighed.<\/p>\n Septic shock mouse model<\/p>\n Male mice on a C57BL\/6J background (6\u2009weeks old) were purchased from Charles River and maintained in a controlled environment for 2\u2009weeks to acclimate them to local conditions. The animal experimental protocol was approved by local and national committees in charge (Tor Vergata University Institutional Animal Care and Use Committee and Ministry of Health, license no. 265\/2019-PR) and conducted in accordance with accepted standards of humane animal care. Mice were intraperitoneally injected with 59\u2009mg\u2009kg\u22121 TMA (Sigma-Aldrich, 72761) (treatment group, n\u2009=\u20097) or PBS alone (control group, n\u2009=\u20096) 30\u2009min before LPS injection (30\u2009mg\u2009kg\u22121 of LPS (Sigma-Aldrich, L2630) in sterile PBS by intraperitoneal injection). The survival of the mice was monitored every 4\u2009h for 36\u2009h.<\/p>\n Mice were housed in standard ventilated cages under a 12\u2009h\u201312\u2009h light\u2013dark cycle at 20\u201323\u2009\u00b0C and 40\u201360% humidity. For mouse experiments, staff who were responsible for phenotyping and biospecimen collection also handled the dietary intervention; therefore, they were not blinded to experimental conditions.<\/p>\n Physiological phenotyping<\/p>\n After 4\u2009weeks of treatment, an intraperitoneal GTT test (2\u2009g\u2009kg\u22121) was performed in conscious mice following an overnight fast. Blood was collected from the tail vein before glucose injection and 30, 60, 90 and 120\u2009min afterwards. Blood glucose levels were determined using an Accu-Check Performa (Roche Diagnostics). Additional blood samples were collected at baseline and 30\u2009min after glucose injection in Microvette CB 300 Lithium Heparin (Sarstedt). Plasma was separated by centrifugation and stored at \u221280\u2009\u00b0C until the insulin radioimmunoassay. Circulating insulin levels were determined using insulin ELISA kits (Mercodia). The Matsuda insulin sensitivity index was calculated as previously published31<\/a>.<\/p>\n After 5\u2009weeks, we performed an ITT. Mice that had been fasted for 5\u2009h were injected intraperitoneally with insulin (0.75\u2009mU\u2009g\u22121; Actrapid, Novo Nordisk). Blood glucose levels were measured immediately before and 15, 30, 45, 60, 90 and 120\u2009min after insulin injection with a standard glucose meter (Accu-Check, Roche) on the tip of the tail vein.<\/p>\n Gene expression<\/p>\n Groups of six mice showing consistent pathophysiological profiles in response to CHD or HFD treatment were selected for microarray analysis performed with our established method75<\/a>, and data were deposited in ArrayExpress under accession number E-MEXP-1755<\/a>. Total RNA was isolated from frozen liver tissue using the Trizol reagent (Invitrogen Life Technologies), followed by further purification with RNeasy spin columns (Qiagen). The concentration and quality of RNA samples were evaluated using an Agilent 2100 Bioanalyser (Agilent Technologies). Gene expression analysis was performed using the Affymetrix Mouse Genome arrays (U430A and U430B). These arrays include 22,690 (U430A) and 22,576 (U430B) probe sets, enabling the detection of transcript levels for approximately 13,250 (U430A) and 7,577 (U430B) unique genes and expressed sequence tags. For each sample, 10\u2009\u03bcg of total RNA was used for first-strand cDNA synthesis, followed by in vitro transcription to generate biotin-labelled complementary RNA (cRNA). The cRNA samples were then assessed for yield and integrity using an Agilent 2100 Bioanalyser. After fragmentation, individual cRNA preparations were hybridized to the microarrays using a temperature-controlled Affymetrix hybridization oven. Post-hybridization washing and staining were carried out using the Affymetrix Fluidics Station 450. Finally, the arrays were scanned at a wavelength of 560\u2009nm with an Agilent scanner (Affymetrix). The Bioconductor77<\/a> package Limma78<\/a> was used to generate the list of differentially expressed genes. Gene ontology was implemented using Enrichr79<\/a>, and signalling pathway impact analysis was conducted using SPIA80<\/a>.<\/p>\n For qPCR analysis, total RNA was prepared from tissues using TriPure reagent (Roche). Quantification and integrity analysis of total RNA were performed by analysing 1\u2009\u00b5l of each sample in an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit). cDNA was prepared by reverse transcription of 1\u2009mg total RNA using a Reverse Transcription System kit (Promega). Real-time PCR was performed with the StepOnePlus real-time PCR system and software (Applied Biosystems) using Mesa Fast qPCR (Eurogentec) for detection according to the manufacturer\u2019s instructions. RPL19 RNA was chosen as the housekeeping gene. All samples were performed in duplicate in a single 96-well reaction plate, and data were analysed according to the 2\u2212\u0394\u0394CT method. The identity and purity of the amplified product were assessed by melting curve analysis at the end of amplification. The primer sequences for the targeted mouse genes are as follows: SAA1 forward, CATTTGTTCACGAGGCTTTCC; SAA1 reverse, GTTTTTCCAGTTAGCTTCCTTCATGT; SAA2 forward, GGGGTCTGGGCTTCCCATCT; SAA2 reverse, CCATTCTGAAACCCTTGTGG; SAA3 forward, CGCAGCACGAGCAGGAT; SAA3 reverse, CCAGGATCAAGATGCAAAGAATG as previously reported81<\/a>. Quantitative PCR with reverse transcription assays were performed in a single batch, with the personnel blinded to treatment groups.<\/p>\n Circulating cytokine quantification<\/p>\n Circulating cytokines were quantified using the MSD V-PLEX Plus Proinflammatory Panel 1 kit. Plasma samples were diluted two times in the diluent provided, and the experiment was processed as outlined by the manufacturer and read on a SECTOR imager 2400. Cytokine assays were performed in a single batch with the personnel blinded to treatment groups.<\/p>\n Western blotting<\/p>\n Western blot analyses were performed according to our established methods82<\/a>. To analyse the insulin signalling pathway, mice were allocated to either a saline-injected subgroup or an insulin-injected subgroup so that both subgroups were matched in terms of body weight and fat mass. They then received 1\u2009mU insulin per g body weight (Actrapid; Novo Nordisk) or an equal volume of saline solution. Then, 3\u2009min after injection, the mice were killed and their liver was dissected. A total of 30\u2009mg of liver was homogenized in 680\u2009\u00b5l of RIPA buffer containing a cocktail of protease and phosphatase inhibitors. The homogenate was then centrifuged at 12,000g for 20\u2009min at 4\u2009\u00b0C. Equal amounts of proteins were separated by SDS\u2013PAGE and transferred to nitrocellulose membranes. Membranes were incubated overnight at 4\u2009\u00b0C with antibodies diluted in Tris-buffered saline Tween-20 containing 1% BSA:p-Akt Ser473 (1:1,000; Cell Signaling Technology, 4060), total Akt (1:1,000; Cell Signalling Technology, 9272S), p-NF-\u03baB (1:3,000; AbCam, ab86299) and total NF-\u03baB p65 (1:3,000; Cell Signalling Technology, 8242). Insulin-induced p-Akt\/total Akt corresponds to the ratio between p-Akt\/Akt in insulin-treated mice and p-Akt\/Akt in saline-treated mice. For these western blots, the membranes were stripped and re-probed with a \u03b2-actin antibody as a loading control. In separate densitometric analyses, we additionally corrected total Akt levels with \u03b2-actin and subsequently used this ratio to correct p-Akt, so as to take into account total protein levels.<\/p>\n 1H-NMR spectroscopy and multivariate statistics<\/p>\n Mouse urine samples were prepared by mixing 200\u2009\u03bcl of urine with 200\u2009\u03bcl of distilled water and 200\u2009\u03bcl of 0.1\u2009M phosphate buffer (containing 10% D2O\/H2O, v\/v, and 0.05% sodium 3-trimethylsilyl-(2,2,3,3-2H4)-1-propionate as a chemical shift reference at \u03b4\u20090.0). The mixtures were loaded into 96-well plates for high-throughput flow-injection NMR spectroscopy. Samples were prepared and measured on a spectrometer (Bruker) operating at 600.22\u2009MHz 1H frequency as detailed previously13<\/a>. In short, a standard 1D pulse sequence (recycle delay-90\u00b0-t1-90\u00b0-tm-90\u00b0-acquisition) was used. Water suppression was performed by irradiating the water peak during the recycle delay (2\u2009s) and mixing time, tm (150\u2009ms); t1 was set to 3\u2009\u03bcs. The 90\u00b0 pulse length was adjusted to \u224810\u2009\u03bcs. We acquired 128 transients at 32,000 a data point resolution for each spectrum with a 20\u2009ppm spectral width. Free induction decays were multiplied by an exponential function corresponding to a 0.3-Hz line-broadening factor before Fourier transformation. The NMR spectra were corrected for phase and baseline. Full-resolution 1H-NMR spectra were imported, and the area corresponding to the water region after water suppression (\u03b44.5\u20135.0) was discarded. The full-resolution spectra were then processed and analysed using O-PLS-DA as we had done previously13<\/a>. In this version of discriminant analysis, class separation is maximized by using NMR data (X) to model the class matrix (Y, with n dummy variables for n classes), through decomposition of the covariance matrix (Y\u1d40X) into n\u2009\u2212\u20091 O-PLS components and additional orthogonal signal correction components13<\/a>. Variance component analysis was performed as described previously83<\/a>. 1H-NMR profiling was performed in a single batch with the personnel blinded to treatment groups. The O-PLS-DA model was validated using 10,000 random permutations of the original class membership variable to explain (that is, diets, treatments or genotypes), as described previously83<\/a>.<\/p>\n Plasma methylamine quantification by UPLC\u2013MS\/MS<\/p>\n Methylamines were quantified according to our previously validated methods29<\/a>,30<\/a>: plasma samples (20\u2009\u03bcl) were spiked with 10\u2009\u03bcl internal standard solution (13C3\/15N-TMA, d9-TMAO, d4-choline, d3-carnitine and d9-betaine in water; 1\u2009mg\u2009l\u22121) and 45\u2009\u03bcl of ethyl 2-bromoacetate solution (15\u2009g\u2009l\u22121 ethyl 2-bromoacetate, 1% NH4OH in acetonitrile) were added to derivatize methylamines (TMA and 13C3\/15N-TMA) to their ethoxy-analogues, completed after 30\u2009min at room temperature. Methylamines were derivatised with ethyl bromoacetate to increase sensitivity (the underivatized form elicited a low response from the mass spectrometer owing to its low molecular weight) and enhance chromatographic performance. A total of 935\u2009\u03bcl of a protein\/lipid precipitation solution (94% acetonitrile\/5% water\/1% formic acid) was added; samples were centrifuged for 20\u2009min (4\u2009\u00b0C, 20,000g) and transferred to UPLC\u2013autosampler vials. Sample injections (10\u2009\u03bcl loop) were performed on a Waters Acquity UPLC-Xevo TQ-S UPLC\u2013MS\/MS system equipped with an Acquity BEH HILIC (2.1\u2009\u00d7\u2009100\u2009mm, 1.7\u2009\u03bcm) chromatographic column. An isocratic elution was applied with 10\u2009mM ammonium formate in 95:5 (v\/v) acetronitrile:water for 14\u2009min at 500\u2009\u03bcl\u2009min\u22121 and 50\u2009\u00b0C. Positive electrospray (ESI+) was used as the ionization source, and mass spectrometer parameters were set as follows: capillary, cone and source offset voltages at 500, 93 and 50\u2009V, respectively; desolvation temperature at 600\u2009\u00b0C; desolvation\/cone\/nebulizer gases were high-purity nitrogen at 1,000\u2009l\u2009h\u22121, 150\u2009l\u2009h\u22121 and 7\u2009bar, respectively. Collision gas was high-purity argon. The mass spectrometer was operated in multiple reaction monitoring mode. The monitored transitions were as follows: for derivatized-TMA, +146 \u2192 +118\/59\u2009m\/z (23\/27\u2009V); for derivatised-13C3\/15N-TMA, +150 \u2192 +63 (27\u2009V); for TMAO, +76 \u2192 +59\/58\u2009m\/z (12\/13\u2009V); for d9-TMAO, +85 \u2192 +68\u2009m\/z (18\u2009V); for choline, +104 \u2192 +60\/45\u2009m\/z (14\/16\u2009V); for d4-choline, +108 \u2192 +60\u2009m\/z (15\u2009V); for \u03b3-butyrobetaine, +146 \u2192 +60\/87\u2009m\/z (12\/12\u2009V); for carnitine, +162 \u2192 +103\/60\u2009m\/z (16\/14\u2009V); for d3-carnitine, +165 \u2192 +103\u2009m\/z (16\u2009V); for betaine, +118 \u2192 +59\/58\u2009m\/z (16\/16\u2009V); and for d9-betaine, +127 \u2192 +68\u2009m\/z (16\u2009V).<\/p>\n Kinome screen, K TMA was assessed using the KdELECT screening service (DiscoveRx) as described previously35<\/a>,36<\/a>. This technique is based on a competition-binding assay that quantitatively measures the ability of a compound to compete with an immobilized, active-site-directed ligand. The assay consists of a DNA-tagged kinase, an immobilized ligand and the potent inhibitor. The ability of TMA to compete with the immobilized ligand was measured by qPCR of the DNA tag. Kd was then calculated from a duplicate 11-point dose\u2013response curve. Kinase interaction tree plots were generated using the TREEspot Software Tool and are reprinted with permission from KINOMEscan, a division of DiscoveRx Corporation, 2015.<\/p>\n Kinase activity assays<\/p>\n The TMA IC50 on IRAK4 was determined using Kinexus kinase-inhibitor activity profiling service (Kinexus). Protein kinase assays (in duplicate) were performed at ambient temperature for 30\u2009min in a final volume of 25\u2009\u03bcl according to the following assay reaction recipe:<\/p>\n Component 1<\/p>\n A total of 5\u2009\u03bcl of diluted active IRAK4 target (recombinant, full length, expressed by baculovirus in Sf9 insect cells with an GST tag (SignalChem Catalogue 112-10G); ~10\u201350\u2009nM final concentration in the assay).<\/p>\n Component 2<\/p>\n A total of 5\u2009\u03bcl of stock solution of substrate (Myelin Basic Protein 1\u2009mg\u2009ml\u22121 diluted in H2O).<\/p>\n Component 3<\/p>\n A total of 5\u2009\u03bcl of kinase assay buffer (25\u2009mM MOPS pH\u20097.2, 12.5\u2009mM \u03b2-glycerol-phosphate, 25\u2009mM MgCl2, 5\u2009mM EGTA, 2\u2009mM EDTA, 0.25\u2009mM dithiothreitol, added just before assay initiation).<\/p>\n Component 4<\/p>\n A total of 5\u2009\u03bcl of compound (various concentrations as indicated) or 10% dimethylsulfoxide for blank.<\/p>\n Component 5<\/p>\n A total of 5\u2009\u03bcl of 32P-ATP (250\u2009\u03bcM stock solution, 0.8\u2009\u03bcCi, Perkin Elmer).<\/p>\n The assay was initiated by the addition of 32P-ATP, and the reaction mixture was incubated at ambient temperature for 30\u2009min. After the incubation period, the assay was terminated by spotting 10\u2009\u03bcl of the reaction mixture onto a Multiscreen phosphocellulose P81 plate, which was washed three times, each time for approximately 15\u2009min, in a 1% phosphoric acid solution. The radioactivity on the P81 plate was counted in the presence of scintillation fluid in a Trilux scintillation counter. Blank control was set up that included all the assay components except the addition of Myelin Basic Protein (replaced with an equal volume of assay dilution buffer). The corrected activity for the IRAK4 target was determined by removing the blank control value.<\/p>\n We calculated the TMA Ki for IRAK4 using the equation below84<\/a>, where IC50\u2009=\u20093.4\u2009\u00b5M, as determined from the IRAK4 activity assay described above. [S] is the concentration of ATP in the assay (50\u2009\u00b5M), and the Km value of IRAK4 for ATP (Km\u2009=\u200913.6\u2009\u00b5M) was provided by the commercial vendor. Purified IRAK4 for these assays was obtained from https:\/\/media.cellsignal.com\/pdf\/7551.pdf<\/a>.<\/p>\n $${K}_{{\\rm{i}}}=\\frac{{\\mathrm{IC}}_{50}}{1+\\frac{[{\\boldsymbol{S}}]}{{K}_{{\\rm{m}}}}}$$<\/p>\n Reagents<\/p>\n Glutamine (Glutamax, 35050061, Life Technologies), FBS (Life Technologies), crystal violet (C6158) and trimethylamine solution (W324108) were obtained from Sigma-Aldrich. Mouse IL-6 Quantikine ELISA kits (M6000B) were obtained from R&D Systems, and the RNeasy Micro Kit was from Qiagen. SuperScript II Reverse Transcriptase, IL-6 Taqman probe Hs00174131_m1 and FAST master mix were purchased from Invitrogen. The HFD (Special Diets Services) and CHD (B&K Universal) were specifically formulated as described in a previous publication12<\/a>; the remaining foods were obtained from Research Diets: control diet (D12450K), LC-HFD (60% kcal fat and 20% kcal carbohydrates; D12492), and HC-HFD (60% kcal fat and 20% kcal carbohydrates with 17\u2009g of choline per kg; D16100401i). The mouse insulin ELISA was obtained from Mercodia (10-1249-01). Additional reagents and kits included isoflurane (10014451, Forene, Abbott); TriPure reagent (1667165, Roche); Reverse Transcription System kit (A3500, Promega); Mesa Fast qPCR (CS-CKIT-PROD, Eurogentec); and the MSD V-PLEX Plus Proinflammatory Panel 1 kit (K15048G Meso Scale Diagnostics).<\/p>\n Statistics<\/p>\n Potential outliers were identified by a Grubbs test. For statistical comparisons between study groups, normality was tested using the D\u2019agostino\u2013Pearson omnibus normality test, then one-way ANOVA was used, followed by Tukey\u2019s post hoc testing when data were normally distributed; otherwise, groups were compared using the two-tailed Mann\u2013Whitney test (P\u2009<\u20090.05 considered to be statistically significant). Where applicable, P\u2009values were corrected for multiple comparisons using the Benjamini\u2013Hochberg method, unless otherwise stated. Data are displayed as means\u2009\u00b1\u2009s.e.m in all figures. All cell culture experiments included at least three biological replicates (as indicated in figure legends). All animal cohorts included at least five animals in each study group (as indicated in figure legends); animals were randomized to treatment groups and were sampled in a random order. Data collection and analysis were not performed blind to the conditions of the experiments. No statistical methods were used to pre-determine sample sizes, but our sample sizes are similar to those reported in our previous publications69<\/a>.<\/p>\n Reporting summary<\/p>\n
\n \u2212\/\u2212 mice<\/p>\n
\n d<\/p>\n