ASO design<\/p>\n
ASOs were designed to bind at the RBS using the MASON algorithm (https:\/\/mason.helmholtz-hiri.de<\/a>)34<\/a> and the NCBI sequence and annotation files (\u03a6KZ: NC_004629.1<\/a>, \u03a6PA3: NC_028999.1<\/a>, PP7: NC_001628.1<\/a>, SPO1: NC_011421.1<\/a>, RAY: NC_041973.1<\/a>, PA14: NC_008463.1<\/a>, PAO1: NC_002516.2<\/a>).\u00a0ASO length was set to 11\u2009nt and the allowed mismatches for off-targets were set to 4\u2009nt. ASOs were selected based on the following scoring values: melting temperature (45\u201355\u2009\u00b0C), low purine percentage (25\u201335%) and few predicted off-targets in distinct translation initiation regions of the phage (<3). The scoring values for the used ASOs are given in Supplementary Data\u00a05<\/a>. At least two ASOs were designed for each targeted gene. The control ASO sequence was GACATAATTGT (ctrl., JVPNA-79). ASOs were commercially ordered at Peps 4LS (Heidelberg) with a peptide backbone (PNA) and an N-terminal RXR (RXRRXRRXRRXRXB), KFF (KFFKFFKFFK) or TAT (GRKKRRQRRRYK) CPP. The initial concentration was adjusted to 1\u2009mM in water based on the specific extinction coefficient using absorption. ASOs were stored at \u221220\u2009\u00b0C. Prior to use, ASOs were thawed at room temperature, heated for 5\u2009min at 55\u2009\u00b0C and then cooled down to room temperature. All ASO sequences are listed in Supplementary Data 5<\/a>, for example, JVPNA-72 for chmA knockdown, JVPNA-125 for nvRNAP knockdown, JVPNA-964 for PicA knockdown, and JVPNA-960 for PhuZ knockdown.<\/p>\n CFU and PFU assay<\/p>\n P. aeruginosa strains PAO1 (JVS-11761, DSMZ: DSM22644), PaLo8, PaLo9, PaLo39, PaLo44 (R. Lavigne laboratory, KU Leuven, Belgium), and PA14 (R. Lavigne laboratory, KU Leuven, Belgium) were grown in LB medium overnight at 37\u2009\u00b0C and 220\u2009rpm. Cells were inoculated 1:100 and grown in Mueller\u2013Hinton medium at 37\u2009\u00b0C and 220\u2009rpm to an absorbance (optical density) of 0.3 (absorption given at 600\u2009nm). ASOs were added at 6\u2009\u00b5M final concentration to 50\u2009\u00b5l cultures and incubated for 30\u2009min. Cells were infected with \u03a6KZ at an MOI\u2009=\u20090.0001 and the cells were incubated for 180\u2009min, which corresponds to three full replication rounds. Five microlitres of cell culture were diluted in series and spotted on LB plates and on 0.5% LB soft agar plates with the susceptible strain PAO1 (one volume of 0.5% LB soft agar at 42\u2009\u00b0C, was mixed with 0.01 volume cells at an optical density of 0.5, and poured into a plate). Plates were imaged with the Typhoon 7000 phosphor imager (GE Healthcare) in fluorescence mode.<\/p>\n For jukA silencing in PA14, the cells were inoculated 1:100 in Mueller\u2013Hinton medium, after 30\u2009min cells were pretreated with 6\u2009\u00b5M ASOs. The cells were infected after 150\u2009min pre-incubation time with \u03a6KZ at an MOI\u2009=\u20090.0001, and incubated further for 180\u2009min followed by CFU and PFU quantification.<\/p>\n For PP7 infection, PAO1 cells were inoculated 1:100 in Mueller\u2013Hinton medium and treated at optical density 0.3 with 0.05\u2009\u00b5M final concentration ASOs, additionally every 30\u2009min 0.05\u2009\u00b5M final concentration ASOs were added. Cells were infected 30\u2009min after starting treatment with PP7 at an MOI\u2009=\u20090.00001, and cells were collected for CFU and PFU analysis after 120\u2009min.<\/p>\n For RAY phage, P. agglomerans (DSMZ: DSM3493)\u00a0cells were grown overnight in LB and were then inoculated 1:100 in Mueller\u2013Hinton medium and grown at 37\u2009\u00b0C, at optical density 0.3, cells were pretreated with 6\u2009\u00b5M RXR\u2013ASOs for 30\u2009min. Cells were infected with phage at an MOI\u2009=\u20090.0001, followed by incubation for 300\u2009min and spotting.<\/p>\n For SPO1 phage, B. subtilis 168 (BGSC:\u00a01A1)\u00a0was grown overnight in LB medium and then inoculated 1:100 in Mueller\u2013Hinton medium, and grown at 37\u2009\u00b0C, at optical density 0.3, cells were pretreated with 6\u2009\u00b5M KFF\u2013ASOs for 30\u2009min. Cells were infected with phage at an MOI\u2009=\u20090.0001, followed by incubation for 180\u2009min and spotting.<\/p>\n Immunoblotting<\/p>\n Infected cell cultures were mixed with final 1\u00d7 SDS\u2013PAGE loading dye (60\u2009mM Tris\/HCl pH 6.8, 0.2\u2009g\u2009ml\u22121 SDS, 0.1\u2009mg\u2009ml\u22121 bromophenol blue, 77\u2009mg\u2009ml\u22121 DTT, 10% (v\/v) glycerol) and were boiled for 10\u2009min at 95\u2009\u00b0C for denaturation. Protein samples were analysed by SDS\u2013PAGE and blotted onto methanol-preactivated polyvinylidene (PVDF) membranes. As a loading control, we used Coomassie staining of a second gel where we loaded the same sample volume. ChmA was produced as previously described16<\/a> in E. coli BL21-CodonPlus (DE3)-RIL cells (Agilent Technologies, JVS-12280, chloramphenicol resistance) that were transformed with pET-M14(+) plasmid carrying the chmA gene with a N-terminal His-V5-TEV-tag (pMiG118). ChmA was purified as described before16<\/a>. The tag could not be removed in the purification procedure. Commercial antibody sera were generated by Eurogentec. Rabbits were immunized with the purified ChmA protein. The rabbit serum (no. 2481) was used at a 1:10,000 dilution together with anti-rabbit HRP-conjugated antibody (Thermo Scientific, 31460) in a 1:10,000 dilution in 5% BSA\/TBST for ChmA detection in immunoblotting. Antibody specificity was validated in immunoblotting by comparison between \u03a6KZ-infected and non-infected cells that yielded a defined band at 70\u2009kDa corresponding to ChmA only in infected cells (Fig. 1c<\/a>).<\/p>\n Microscopy<\/p>\n Agarose (0.85% (w\/v)) was dissolved in fivefold water-diluted LB medium and boiled to melt. The liquid agarose was poured on microscope slides with one slide pair at each side as a spacer and one slide on top to form a closed gel slice as described61<\/a>. After solidification, approximately 1\u2009cm\u2009\u00d7\u20091\u2009cm pads were cut. Cells were grown in Mueller\u2013Hinton medium at 220\u2009rpm and 37\u2009\u00b0C to an A600\u2009nm\u2009\u2248\u20090.3, then preincubated with 8\u2009\u00b5M ASOs for 30\u2009min, and infected with \u03a6KZ or \u03a6PA3 at an MOI\u2009=\u200910. Of note, \u03a6KZ \u0394phuZ had a low titre owing to deletion of phuZ and could only be infected with an MOI of ~0.001. At indicated time points the phage replication cycle was quenched by cooling the cells on ice for 10\u2009min and the cells were pelleted at 8,000g for 5\u2009min. The supernatant was removed, and the cells were resuspended in 500\u2009\u00b5l 4% paraformaldehyde and incubated for 15\u2009min on ice. Afterwards cells were washed with PBS and were resuspended in 50\u2009\u00b5l PBS for storage at 4\u2009\u00b0C. For the imaging of the \u03a6KZ155 knockdown, we crosslinked bacteria in the medium with 2% glutaraldehyde for 30\u2009min on ice, followed by the addition of 5% formaldehyde for 30\u2009min on ice, as previously described62<\/a>. Cells were stained with 16\u2009\u00b5M FM4-64, and 360\u2009nM DAPI and 5\u2009\u00b5l were layered onto 1.2% agarose pads. The pad was placed with the side of application downwards into a \u00b5-Slide 8 Well high Grid-500\u00a0(BD Biosciences). Transmission and fluorescence were detected with a confocal laser scanning microscope Leica SP5. Images were processed with ImageJ (1.53).<\/p>\n For the imaging of \u03a6KZ155\u2013GFP, PAO1 cells were transformed with a plasmid (pLBu005) encoding \u03a6KZ155-gfp under the control of an arabinose-inducible pBAD promoter and selected on gentamycin plates. The cells (JVS-13713) were grown to an optical density of 0.25 and induced with arabinose at indicated concentrations followed by phage infection with an MOI\u2009=\u200910 at optical density 0.3. The collection, crosslinking and imaging of cells was conducted as described above for wild-type cells.<\/p>\n Proteomics<\/p>\n PAO1 cells were grown overnight in LB medium and were then inoculated 1:100 in Mueller\u2013Hinton medium and grown at 37\u2009\u00b0C and 220\u2009rpm for 150\u2009min to optical density 0.3. Cells were pretreated for 30\u2009min with 6\u2009\u00b5M ASOs against chmA, nvRNAP transcript (\u03a6KZ055), and picA. Subsequently, cells were infected with \u03a6KZ at an MOI\u2009=\u20095. At 2.5, 5.0, 7.5 and 10.0\u2009min p.i. cells were collected with addition of 1\/3 volume 4\u00d7 Bolt SDS sample buffer (Invitrogen), and were immediately boiled at 95\u2009\u00b0C for 5\u2009min. Mass spectrometry sample preparation and measurement was conducted at the Proteomics Core Facility EMBL Heidelberg as previously described37<\/a>. Proteins were quantified using label-free quantification (LFQ). Enrichment as log10-transformed P values was calculated with a two-sided Student\u2019s t-test in MaxQuant Perseus (2.1.3)63<\/a>.<\/p>\n RNA preparation and RNA-seq<\/p>\n PAO1 was grown overnight in LB at 37\u2009\u00b0C 220\u2009rpm. Cells were inoculated 1:100 in Mueller\u2013Hinton medium at 37\u2009\u00b0C and grown to an optical density of 0.3. 6\u2009\u00b5M ASO (JVPNA-79 for control or JVPNA-72 for chmA inhibition) were added to 1.6\u2009ml of cell culture and incubated for 30\u2009min at 37\u2009\u00b0C 220\u2009rpm. Cells were infected with \u03a6KZ at an MOI\u2009=\u20095. At indicated time points, 250\u2009\u00b5l were removed and incubated on ice. Infection efficiency was independently validated by confocal microscopy and CFU spotting with 50\u2009\u00b5l of cells. RNA was isolated from 200\u2009\u00b5l of cells using the RNAsnap procedure64<\/a>. Two volumes of RNAprotect (Qiagen) were added and cells were incubated for 5\u2009min. Cells were pelleted at full speed for 20\u2009min at 4\u2009\u00b0C and the supernatant was removed. The pellet was resuspended in 100\u2009\u00b5l SNAP buffer (0.025% SDS, 18\u2009mM EDTA, 1% \u03b2-mercaptoethanol, 95% formamide (RNA-grade)). Samples were incubated for 7\u2009min at 95\u2009\u00b0C, cell debris was pelleted at full speed for 5\u2009min at room temperature, and the supernatant was transferred to a new tube. 1.5 volumes of ethanol were added to the supernatant and the sample was mixed by pipetting. The sample was loaded onto a miRNeasy mini column (Qiagen) two times and spun at full speed for 20\u2009s at room temperature. Columns were washed two times with 500\u2009\u00b5l RPE buffer (Qiagen) and spun at 8,000g for 1\u2009min at room temperature. One final spin was used to dry the column in an empty tube. Thirty microlitres of RNase-free water was added to the column and the RNA eluted at 8,000g for 1\u2009min at room temperature. The elution was repeated with the flow-through to recover more RNA. The RNA concentration was determined by absorption at 260\u2009nm. RNA was stored at \u221280\u2009\u00b0C.<\/p>\n RNA-seq was performed at the CoreUnit SysMed at the University of W\u00fcrzburg. DNA was digested with DNaseI and the rRNA was depleted with the Lexogen RiboCOP META depletion kit. RNA library was prepared with the CORALL Total RNA-Seq Library Prep Kit V1 (Lexogen). The library was sequenced on a\u00a0NextSeq2000 (Illumina) machine with a P1-seq kit (single-end 1\u00d7 100\u2009bp, Illumina). RNA-seq analysis for the ChmA knockdown and the screen was conducted with READemption 0.4.3 and 2.0.4, respectively65<\/a>. Reads were aligned for PAO1 and \u03a6KZ to NC_002516<\/a> and NC_004629<\/a>, respectively. Enrichment of transcripts was calculated with the DeSeq2 module in READemption (2.0.4)65<\/a>. Read coverage was illustrated with the Integrated Genomics Viewer (IGV)66<\/a>.<\/p>\n We defined early and middle\/late phage transcripts based on their significant enrichment (log2fold\u2009>\u20092 or log2fold\u2009<\u2009\u22122, \u2212log10-adjusted P value\u2009>\u200910) between the control 35- and 10-min samples (Extended Data Fig. 6a<\/a>, as in ref. 44<\/a>).<\/p>\n Structure prediction<\/p>\n Structures were predicted from protein sequences using Google AlphaFold3 server (https:\/\/alphafoldserver.com\/<\/a>)67<\/a>. This information is subject to AlphaFold Server Output Terms of Use found at https:\/\/alphafoldserver.com\/output-terms<\/a> (Google LLC). Ongoing use is subject to AlphaFold Server Output Terms of Use and of any modifications made. For the RNase HI domain structure in Fig. 4b<\/a>, the predicted reference structure A0A2A2IBB4 was used from the AlphaFold Protein Structure Database (https:\/\/alphafold.ebi.ac.uk\/<\/a>).<\/p>\n Complementation assay<\/p>\n PAO1 cells were transformed with pLBu019_\u03a6KZ155-TEV-3xFlag and pLBu021_\u03a6KZ155CDN-TEV-3xFlag and selected with gentamycin. Cells were grown overnight in LB medium with gentamycin. For the assay, no gentamycin was used in the medium. Cells were inoculated 1:100 in Mueller\u2013Hinton medium. Cells were treated with 6\u2009\u00b5M ASOs against control or \u03a6KZ155 for 30\u2009min. For spotting, cells were infected with \u03a6KZ at an MOI\u2009=\u20090.0001, the complementation gene was induced with 0.2% arabinose, and cells were spotted at 180\u2009min p.i. For imaging, cells were infected with \u03a6KZ at an MOI\u2009=\u200910, the complementation gene was induced with 0.2% arabinose, and cells were chemically crosslinked at 35\u2009min p.i. and stained with FM4-64 and DAPI as described in the microscopy section\u00a0and imaged.<\/p>\n In vitro translation<\/p>\n Template DNA was produced via PCR and Taq-polymerase followed by gel purification. Primers JVO-23244 and JVO-23245 were used to amplify wt \u03a6KZ155 with a T7 promoter from \u03a6KZ lysate, and for \u03a6KZ155D102N, pLBu021 was used as template. Template DNA (250\u2009ng) was supplemented in 10\u2009\u00b5l PURExpress in vitro protein synthesis kit mix (NEB, E6800). The reaction mix was incubated for 120\u2009min at 37\u2009\u00b0C and was subsequently used for assays.<\/p>\n Cleavage assays<\/p>\n RNA template (JVRNA-001, AUAUAAGGGAACAUAGAUAAACCCCUCCCUAAUAAAAUG) was labelled with 5\u2032-32P. For the RNA\u2013DNA duplex, the radiolabelled RNA was mixed with twice the amount of the reverse complement DNA (JVO-23273), boiled and slowly cooled down to room temperature in a water bath to anneal the duplexes. One picomole of RNA or RNA\u2013DNA duplex was added to 2\u2009\u00b5l PURExpress IVT mix that was translating for 2\u2009h a control, \u03a6KZ155 or \u03a6KZ155(D102N). The mix was incubated for 1\u2009h, mixed with 1 volume GLII buffer, boiled for 5\u2009min, rapidly cooled down on ice, and loaded onto a 6% 6\u2009M Urea\u2013PAGE (19:1) gel that was run at 300\u2009V for 2\u2009h. The gel was transferred onto Whatman filter paper, vacuum dried, and a phosphor image screen was used to read out the autoradiogram on a Typhoon FLA7000 imager (GE Healthcare). As a positive control, we used a commercially available RNase H (NEB, M0297S).<\/p>\n Southern dot blotting<\/p>\n PAO1 cells were grown to an optical density of 0.3 in Mueller\u2013Hinton medium and were pretreated with 6\u2009\u00b5M ASOs against \u03a6KZ155 (\u03a6KZ) or gp176 (\u03a6PA3) for 30\u2009min. Cells were infected at an MOI\u2009=\u20095 with \u03a6KZ. At indicated time points a fraction of the culture was removed and 1% SDS was added followed by boiling at 95\u2009\u00b0C for 5\u2009min. Subsequently, the DNA was extracted from the sample with phenol choloroform:isoamyl alcohol, and subsequently with one volume of chloroform. The aqueous phase was supplemented with 1.5 volume 1\u2009M NaOH and 15\u2009mM EDTA (pH 9). The sample was heated for 3\u2009min at 95\u2009\u00b0C and put on ice for 5\u2009min. The solution was filtered with a dot blot apparatus through an equilibrated (0.3\u2009M NaOH) and positively charged nylon membrane. Subsequently, the membrane was dried and the DNA crosslinked via exposition to UV light for 5\u2009min. The membrane was equilibrated with hybridization solution two times, and a radiolabelled oligo was added for hybridization overnight starting at 60\u2009\u00b0C for 1\u2009h and then 48\u2009\u00b0C overnight. The membrane was washed once for 15\u2009min with 2\u00d7 SSC and with 0.5\u00d7 SSC, and a screen was used for phosphor imaging on a Typhoon FLA7000 imager (GE Healthcare).<\/p>\n Reporting summary<\/p>\n