Cell lines<\/p>\n
B16-F0 (ATCC; CRL-6322) and its LN metastatic derivatives: NBF0-LN1-18IL, NBF0-LN7-1112AR, NBF0-LN7-1120BL, NBF0-LN7-1134BL, NBF0-LN8-1194BR, NBF0-LN8-1198AR, NBF0-LN8-1205BL, NBF0-LN9-1315BL and NBF0-LN9-1358IR\u2014were provided by the Reticker-Flynn Laboratory. For simplicity, these cell lines are referred to throughout the manuscript as: B16-F0, LN1-18IL, LN7-1112AR, LN7-1120BL, LN7-1134BL, LN8-1194BR, LN8-1198AR, LN8-1205BL, LN9-1315BL and LN9-1358IR, respectively. B16F10 wild-type (WT), B16F10 Fsp1-KO and B16F10 Gpx4-KO cells were obtained from the Conrad Laboratory. B16-F0 Fsp1-KO, LN7-1134BL Fsp1-KO, LN9-1315BL Fsp1-KO, B16-F0 Gclc-overexpression, LN7-1134BL Gclc-overexpression, B16-F0 Gclc-KO and B16-F0 Nrf2-overexpression lines were generated in this study. Human melanoma cell lines MeWo, SK-MEL-5, A375, murine melanoma lines Yale University Melanoma Model (YUMM) 3.3 and YUMM 5.2, and HEK293T cells were purchased from ATCC. All cell lines were cultured in Dulbecco\u2019s modified Eagle\u2019s medium (DMEM; Thermo Fisher Scientific, 11885076) supplemented with 10% FBS (Thermo Fisher Scientific, 26400044) and 1% penicillin\u2013streptomycin (Thermo Fisher Scientific, 15140122). All of the other lines were authenticated by ATCC using STR profiling. Cells were routinely tested for mycoplasma contamination using MycoStrip (InvivoGen, rep-mys-50).<\/p>\n
Chemicals<\/p>\n
RSL3 (HY-100218A), erastin-2 (HY-139087), iFSP1 (HY-136057), BTZ (HY-10227) and PEG300 (HY-Y0873) were purchased from MedChemExpress. ML-210 (S0788), MG-132 (S2619) and icFSP1 (E1535) were acquired from Selleck Chemicals. Rotenone (R8875), oligomycin (75351), antimycin A (A8674), L-BSO (B2515), N-acetyl cysteine (A9165), Na2SeO3 (S5261), CQ (C6628) and PEG400 (202398) were obtained from Sigma-Aldrich. FCCP (15218), MTT (21795), GSHee (14953), liproxstatin-1 (17730), IMP-1088 (25366), NSC 624206 (20569), FSEN1 (38025), viFSP1 (39927) and triacsin C (10007448) were obtained from Cayman Chemical Company. MitoView Fix 640 (70082) and LipidSpot 488 (70065) were sourced from Biotium. Lipofectamine 3000 (L3000015), Bodipy 581\/591 C11 (D3861), SYTOX Green (S7020), Lysotracker Deep Red (L12492) and NucBlue Live ReadyProbes Reagent (R37605) were from Thermo Fisher Scientific.<\/p>\n
Plasmids<\/p>\n
pCMV3-FSP1-OFP plasmid (MG52065-ACR) was obtained from Sino Biological. Lenti-luciferase-P2A-neo (Addgene, 105621), psPAX2 (Addgene, 12260), pMD2.G (Addgene, 12259) and PX458 (Addgene, 48138) were obtained from Addgene. Custom constructs including pTWIST-mFSP1-G2A-OFP, pLVX-EF1\u03b1-GCLC-IRES-Hygro, and pLVX-EF1\u03b1-NRF2-IRES-Hygro were synthesized by Twist Bioscience and cloned into expression vectors using Gibson Assembly.<\/p>\n
Generation of stable cell lines<\/p>\n
Stable cell lines expressing luciferase, GCLC or NRF2 were generated through lentiviral transduction followed by antibiotic selection. Lentivirus was produced by co-transfecting HEK293T cells with 5\u2009\u00b5g of either Lenti-luciferase-P2A-neo, pLVX-EF1\u03b1-GCLC-IRES-Hygro or pLVX-EF1\u03b1-NRF2-IRES-Hygro, combined with 5\u2009\u00b5g psPAX2 and 0.5\u2009\u00b5g pMD2.G using Lipofectamine 3000. Virus-containing supernatants were collected every 24\u2009h for 48\u2009h, filtered and supplemented with 8\u2009\u00b5g\u2009ml\u22121 Polybrene (Sigma-Aldrich, H9268). Target cells were infected and subsequently selected with either 1,500\u2009\u00b5g\u2009ml\u22121 G418 or 1,000\u2009\u00b5g\u2009ml\u22121 hygromycin B for 6\u2009days to establish stable populations.<\/p>\n
CRISPR\u2013Cas9-mediated gene KO<\/p>\n
To generate Fsp1- or Gclc-KO cell lines in B16-F0 and its LN metastatic derivatives, sgRNAs were designed with BbsI-compatible overhangs and cloned into the PX458 Cas9-GFP vector. The sgRNA sequences were as follows: Fsp1 (CACCGGCGGCTGCCAGCCAGCTGC) and Gclc (CACCGGGGAGTTACATGATCGA). sgRNA insertion was confirmed by whole-plasmid sequencing. Cells were transfected with PX458-sgRNA constructs using Lipofectamine 3000 and GFP-positive cells were sorted by flow cytometry and expanded. Transfection and cell sorting was repeated a second time to generate a pure population for expansion prior to validation. KOs were validated by western blotting and Sanger sequencing (Extended Data Fig. 8i,j<\/a> for FSP1 and Extended Data Fig. 5j<\/a> for GCLC).<\/p>\n LN9-1315BL Fsp1-KO cell lines were generated by lentiviral transduction using the LCv2_Blast vector containing mouse Fsp1 sgRNA 1 (sequence: CACCGCCGTGCACGTGGTGATCGT), previously validated43<\/a>. Transduced cells were selected with 5\u2009\u00b5g\u2009ml\u22121 blasticidin. KO validation is shown in Extended Data Fig. 9c<\/a>.<\/p>\n Western blot analysis<\/p>\n Cell lysates (15\u201320\u2009\u03bcg protein) were separated by SDS\u2013PAGE, transferred onto PVDF membranes (Bio-Rad, 1620177), blocked with 5% non-fat milk in TBS-T or PBS-T, and incubated with primary antibodies overnight at 4\u2009\u00b0C in 5% non-fat milk in PBS-T. After washes, the membranes were incubated with HRP-conjugated secondary antibodies and proteins detected by enhanced chemiluminescence (Thermo Fisher Scientific, 32106). The following antibodies were used: ACSL3 (Abcam, ab151959, 1056272-1, WB,1:5,000, Ms), ACSL4 (Santa Cruz Biotechnology, A-5, I1222, WB,1:200, Ms), actin (MP Biomedical, 691001, 0101008716, WB, 1:20,000, Ms and Hu), FSP1 (Proteintech, 20886-1-AP, 00111298, WB,1:2,000, KD validated in-house, Ms and Hu), anti-mouse IgG HRP (Cell Signaling, 7076S, 36, WB, 1:5,000), anti-rabbit IgG HRP (Cell Signaling, 7074S, 33, WB, 1:5,000), COX IV (Cell Signaling, 4850, 11, WB, 1:1000, Ms), GAPDH (Santa Cruz Biotechnology, 6C5, J2523, WB, 1:20,000, Ms), GCLC (Santa Cruz Biotechnology, H-5, J0621, WB, 1:2,000, KO validated in-house), GPX4 (Abcam, ab125066, lot 1000287-43, WB, 1:2,000, KO validated in-house), HIF-1\u03b1 (Cell Signaling, 36169, 5, WB, 1:1,000), LAMP1 (Abcam, ab24170, GR3235630-1, WB, 1:1,000, Ms), LAMP2A (Abcam, ab18528, 1029399-1, WB, 1:1,000, Ms), LC3 (Cell Signaling, 3868, 14, WB, 1:1,000), LIMPII (Proteintech, 27102-1-AP, WB), NRF2 (Proteintech, 16396-1-AP, 00116728, WB, 1:5,000), NRF2 (Proteintech, 80593-1-RR, 23013625, WB, 1:1,000), PDIA3 (AMAB90988, WB, 1:200), RCAS1 (Cell Signaling, 12290S, D2B6N, 6, WB, 1:1,000), SCL7a11\/xCT (Cell Signaling, 98051, 1, WB, 1:300), ubiquitin (Cell Signaling, 43124T, 4, WB, 1:1,000), \u03b3-tubulin (Cell Signaling, T5326, WB, 1:1,000).<\/p>\n Immunoprecipitation and ubiquitination detection<\/p>\n B16-F0 and LN7 1134BL cells were incubated under normoxic (21% O2) or hypoxic conditions (1% O2) for 16\u2009h. Proteins were extracted with RIPA buffer plus protease and phosphatase inhibitors. For denatured immunoprecipitation, lysates were heated to 95\u2009\u00b0C for 5\u2009min. Both native and denatured lysates were incubated with anti-GPX4 antibody (Proteintech, 67763-1-Ig, 10027815) or mouse IgG control (Proteintech, B900620) overnight at 4\u2009\u00b0C, followed by incubation with anti-mouse IgG Sepharose beads (Cell Signaling, 5946) for 6\u2009h at 4\u2009\u00b0C. Beads were washed with RIPA buffer and analysed by immunoblotting using the anti-ubiquitin antibodies (Cell Signaling, 43124T, 4, WB, 1:1,000).<\/p>\n IHC analysis<\/p>\n A TMA containing primary cutaneous melanoma and LN metastases (ME551; TissueArray.com) was used to assess the expression of GCLC, GPX4 and FSP1. The sections were stained with antibodies against GPX4 (Abcam, ab125066, 1:500), GCLC (Santa Cruz, sc-390811, 1:500) and FSP1 (Proteintech, 68049-1-Ig, 1:500) using the Zytomed Permanent AP Red Kit (ZUC001-125) according to the manufacturer\u2019s instructions, followed by counterstaining with haematoxylin. The slides were scanned with an Axio Scan.Z1 slide scanner (Zeiss). Quantification of AP Red signal intensity was performed using QuPath (v.0.5) with uniform thresholding parameters across all samples.<\/p>\n FSP1 enzyme activity<\/p>\n NADH consumption assays were performed in PBS (Gibco, 14190094) containing 15 or 25\u2009nM recombinant non-myristoylated human FSP1, 100\u2009\u03bcM menadione (Sigma-Aldrich, M5625) and 200\u2009\u03bcM NADH43<\/a>. The pH of the final reaction was adjusted from 4.0 to 9.0 by titrating PBS with HCl or NaOH. After the addition of FSP1, the absorbance at 340\u2009nm was recorded every 20\u2009s at 37\u2009\u00b0C using the SpectraMax M5 microplate reader (Molecular Devices). Reactions lacking NADH or enzyme were included for background correction. Data were normalized and fitted using GraphPad Prism 10.<\/p>\n Confocal fluorescence microscopy<\/p>\n Cells plated on coverslips were transfected with FSP1-OFP using Lipofectamine 3000. After 16\u2009h, cells were treated with IMP-1088 (0.1\u2009\u03bcM) for 24\u2009h. Cells were fixed (4% paraformaldehyde), permeabilized (0.1% Triton X-100), and incubated overnight with primary antibodies in 3% BSA\/PBS and then with by Alexa-Fluor-conjugated secondary antibodies. For live-cell imaging, cells were plated on 30-mm glass-bottom dishes, transfected as described above, and incubated with Lysotracker (50\u2009nM) and NucBlue Live ReadyProbes reagent during the final 30\u2009min of IMP-1088 treatment. Images were captured with a Nikon Eclipse Ti confocal microscope using consistent settings for comparisons and analysed with Fiji software. Antibodies and stains used included Alexa Fluor 647 donkey anti-rat (Thermo Fisher Scientific, A48272, YK388772, IF, 1:500), Alexa Fluor 488 goat anti-rabbit (Thermo Fisher Scientific, A32731, YI374177, IF, 1:500), Alexa Fluor 546 goat anti-rabbit (Thermo Fisher Scientific, A11010, 2570547, IF, 1:500), ERp72 (Cell Signaling, 5033, 4, IF, 1:200) GPX4 (Abcam, ab125066, 1000287-7, IF, 1:100, KO validated in-house) from Abcam; LAMP1 (Thermo Fisher Scientific, 14-1071-82, 2698949, IF, 1:50), RCAS1 (Cell Signaling, 12290, 6, IF, 1:200), MitoView Fix640 (70082-50 \u03bcg, 23M0201-1215003) and LipidSpot 488 (70065, 22L0820) from Biotium.<\/p>\n Lipid oxidation assays<\/p>\n Cells (60,000 per well) were seeded in 12-well plates one day before treatment. Cells were treated with 0.5\u2009\u00b5M RSL3 for 4\u2009h or 1% O2 for 24\u2009h, washed with PBS, trypsinized and resuspended in PBS containing 1.5\u2009\u00b5M C11-BODIPY 581\/591 (Invitrogen, D3861). After 30\u2009min incubation at 37\u2009\u00b0C, cells were washed, incubated with DAPI, filtered through a 70-\u00b5m strainer and analysed on the BD LSR Fortessa flow cytometer. Excitation was performed at 488\u2009nm, detecting oxidized BODIPY (FITC, 525\/40\u2009nm) and reduced BODIPY (PE, 585\/42\u2009nm). At least 10,000 events were analysed per sample. Data were processed using FlowJo software, and the lipid oxidation ratio (FITC\/PE ratio) was calculated as (median FITC-A \u2212 median FITC-A unstained)\/(median PE-A \u2212 median PE-A unstained). The flow cytometry gating strategies for the lipid oxidation assays are presented in Supplementary Fig. 2<\/a>.<\/p>\n Cell viability and cell death assays<\/p>\n Cells (2,500\u20133,000 per well) were seeded into 96-well plates. Viability was measured using MTT assay 24\u2009h (erastin-2) or 48\u2009h (RSL3, ML-210, viFSP1 + BSO and Triacsin C) after treatment. Cell death was monitored every 3\u2009h using SYTOX Green (25\u2009nM) in the Incucyte S3 (Sartorius) system.<\/p>\n Isolation of lysosome-enriched fractions<\/p>\n Lysosome-enriched fractions were isolated using the Lysosome Isolation Kit (Abcam, ab234047) according to the manufacturer\u2019s protocol. In brief, 2\u2009\u00d7\u2009107 cells were washed and centrifuged at 600g for 10\u2009min and the supernatant was removed. Cells were resuspended in Lysosome Isolation Buffer, vortexed and incubated on ice for 2\u2009min. Complete cell disruption was obtained using a dounce homogenizer. After adding Lysosome Enrichment Buffer, the homogenate was centrifuged at 500g for 10\u2009min at 4\u2009\u00b0C. The supernatant was added to the top of a discontinuous gradient density and an ultracentrifugation at 145,000g for 2\u2009h at 4\u2009\u00b0C was performed. The lysosome-enriched fraction was present in the top 10% of the gradient volume. For western blot analyses, the protein content of the lysosomal-enriched gradient supernatant was quantified using the Qbit 1 fluorometer (Thermo Fisher Scientific) and a protein quantification kit (Thermo Fisher Scientific, Q33212). Equal total protein amounts of total cell extracts and lysosome-enriched extracts were loaded for comparison for western blot analyses.<\/p>\n Isolation of Golgi-enriched fractions<\/p>\n Golgi-enriched fractions were isolated using the Golgi enrichment extraction kit (Invent, GO-037) according to the manufacturer\u2019s instructions. In brief, filter cartridges were placed and cooled on ice for several minutes. Then, 2\u2009\u00d7\u2009107 cells were trypsinized and collected by centrifugation at 500g, washed with 1\u00d7 PBS and centrifuged again at 500g. The pellet was resuspended in buffer A with vigorous shaking. The filter cartridge was capped, the tube inverted several times and centrifuged at 16,000g for 30\u2009s. The tube was then centrifuged at 4\u2009\u00b0C at 5,000g for 5\u2009min without removing the filter. The filter was then removed and the supernatant transferred to a fresh tube and centrifuged at 4\u2009\u00b0C at 16,000g for 30\u2009min. The supernatant was then transferred to a fresh tube. An equivalent in volume of buffer B was added to the supernatant, the resulting mixture incubated on ice for 15\u2009min and then centrifuged at 8,000g for 5\u2009min. The pellet was then resuspended in buffer A and mixed by pipetting up and down 50 times and subsequently centrifuged at 8,000g for 5\u2009min. The supernatant was then transferred to a fresh tube and ice old buffer C was added, mixed by vortexing for 20\u2009s and incubated on ice for 20\u2009min. The tube was then centrifuged at 8,000g for 10\u2009min and the supernatant removed. The pellet was resuspended Laemmli buffer for subsequent western blot analysis. For western blot analyses, the protein content of the Golgi-enriched extracts was quantified using the Qbit 1 fluorometer (Thermo Fisher Scientific) and a protein quantification kit (Thermo Fisher Scientific, Q33212). Equal total protein amounts of total cell extracts and lysosome-enriched extracts were loaded for comparison for western blot analyses.<\/p>\n Isolation of ER-enriched fraction<\/p>\n ER were isolated using the ER enrichment extraction kit (Novus Biologicals, NBP2-29482) according to the manufacturer\u2019s instructions. In brief, 500\u2009\u00b5l of 1 \u00d7 isosmotic homogenization buffer followed by 5\u2009\u00b5l of 100\u00d7 PIC were added to a pellet of 2\u2009\u00d7\u2009107 cells. The resulting suspension was centrifuged at 1,000g for 10\u2009min at 4\u2009\u00b0C. The supernatant was transferred to a clean centrifuge tube and centrifuged at 12,000g for 15\u2009min at 4\u2009\u00b0C. The floating lipid layer was discarded. The supernatant was centrifuged in a clean centrifuge tube using an ultracentrifuge at 90,000g for 1\u2009h. The resulting pellet contained the total ER fraction (rough and smooth). The pellet was resuspended Laemmli buffer for subsequent western blot analysis. For western blot analyses, the protein content of the ER-enriched extracts was quantified using the Qbit 1 fluorometer (Thermo Fisher Scientific) and a protein quantification kit (thermo Fisher Scientific, Q33212). Equal total protein amounts of total cell extracts and lysosome-enriched extracts were loaded for comparison for western blot analyses.<\/p>\n Mitochondrial\/cytoplasmic fractionation<\/p>\n Mitochondrial and cytoplasmic fractions were obtained using a mitochondria isolation kit for mammalian cells (89874) from Thermo Fisher Scientific according to the manufacturer\u2019s instructions.<\/p>\n RNA-seq analyses<\/p>\n RNA-seq data were generated and analysed as described previously15<\/a>. Raw sequencing reads were trimmed and quality-filtered using Trimmomatic and FastQC, respectively. Transcript abundance was quantified with Salmon v.0.7.2 using quasi-mapping mode and corrected for sequence, GC and positional biases, using the mouse genome GRCm38 GENCODE release M11. TPM values were computed using tximport and renormalized after removing mitochondrial transcripts. Differential expression analysis was performed using DESeq2 with regularized log-transformed counts. Hierarchical clustering and PCA analyses used Spearman correlations from the top 1,000 highly variable genes. Heat maps (Extended Data Fig. 1a<\/a>) were generated using heatmap3 from the top 200 differentially expressed genes. Data have been deposited in the Gene Expression Omnibus (GEO: GSE117529<\/a>).<\/p>\n ATAC\u2013seq analyses<\/p>\n ATAC\u2013seq analyses were conducted as described previously15<\/a>. In brief, cells were permeabilized and DNA was transposed using Tn5 transposase. Libraries were purified, amplified and sequenced (NovaSeq, 2\u2009\u00d7\u2009100 cycles, around 50\u2009million paired reads per sample). Reads were mapped to mm10 (hisat2), duplicates removed (Picard) and peaks were called using MACS2. Normalized coverage was visualized in IGV. Transcription factor activity and motif enrichment were assessed with Chromvar and HOMER, respectively. Data were deposited at the GEO (GSE117529<\/a>).<\/p>\n RNA isolation and qPCR analyses<\/p>\n RNA was extracted using the RNeasy Plus Mini Kit (Qiagen, 74134), and cDNA was synthesized using the iScript Reverse Transcription Supermix (Bio-Rad, 1708841). qPCR was performed using the iTaq Universal SYBR Green Supermix (Bio-Rad, 1725121) on the BioRad CFX96 system. The primers used were as follows: mNRF2_F: AACGACAGAAACCTCCATCTAC; mNRF2_R: AGTAAGGCTTTCCATCCTCATC; mFSP1_F: GCAATGAGTATCGGGAGTACAT; mFSP1_R: GTAGGCAGAGCTGTTGATCTT; mGPX4_F: ACTGACGTAAACTACACTCAGC; mGPX4_R: GGAAGGCCAGGATTCGTAAA; RNA pol II_F: ACTGTGCGGAACTCCATCAA; RNA pol II_R: AGCCAGGTTCTGGAACTCAA; mPPIB_F: CATCAAGGACTTCATGATCCA; mPPIB_R: ATAGATGCTCTTTCCTCCTGTG. RNA pol II and PPIB amplification were used as reference genes. PPIB was used as a housekeeping gene for qPCR analyses of parental and LN metastatic lines, while RNA Pol II was used for qPCR analyses of BTZ treatment under 21% and 1% O2 conditions.<\/p>\n Metabolite extraction and LC\u2013MS analysis<\/p>\n For metabolite extraction, 5\u2009\u00d7\u2009105 cells were seeded into 6-well plates and cultured for 24\u2009h. The medium was then aspirated, and cells were washed with cold normal saline (9\u2009g\u2009l\u22121 sodium chloride). Immediately, 400\u2009\u00b5l of extraction buffer (methanol:acetonitrile:water, 40:40:20, with 0.5% formic acid) was added per well, and the plates were incubated on ice for 5\u201310\u2009min. The samples were neutralized with 35\u2009\u00b5l of 15% ammonium bicarbonate (NH4HCO3), cells were scraped and lysates were transferred to 1.5\u2009ml tubes and centrifuged at 16,000\u2009rpm for 15\u2009min. A total of 80\u2009\u00b5l of supernatant was transferred to LC\u2013MS vials, and 20\u2009\u00b5l from each sample was pooled to generate a quality control sample. All of the extracts were stored at \u201380\u2009\u00b0C until analysis.<\/p>\n Metabolites were analysed using a Q Exactive HF mass spectrometer (Thermo Fisher Scientific) coupled to hydrophilic interaction chromatography (HILIC). Separation was performed using an XBridge BEH Amide XP column (2.5\u2009\u00b5m, 2.1\u2009\u00d7\u2009150\u2009mm) with a guard column (2.5\u2009\u00b5m, 2.1\u2009\u00d7\u20095\u2009mm; Waters). Mobile phase A consisted of water:acetonitrile (95:5) and mobile phase B comprised water:acetonitrile (20:80), both containing 10\u2009mM ammonium acetate and 10\u2009mM ammonium hydroxide. The gradient was as follows: 0\u20133\u2009min, 100% B; 3.2\u20136.2\u2009min, 90% B; 6.5\u201310.5\u2009min, 80% B; 10.7\u201313.5\u2009min, 70% B; 13.7\u201316\u2009min, 45% B; 16.5\u201322\u2009min, 100% B. The flow rate was 0.3\u2009ml\u2009min\u22121. The autosampler was maintained at 4\u2009\u00b0C and the column at 30\u2009\u00b0C. The injection volume was 5\u2009\u00b5l. Needle washes were performed between injections using acetonitrile:methanol:water (4:4:2, v\/v\/v).<\/p>\n MS1 scans were acquired from m\/z 70 to 1,000 with polarity switching and a resolution of 120,000 (at m\/z 200). Other MS parameters were as follows: sheath gas, 40; auxiliary gas, 10; sweep gas, 2; spray voltage, 3.5\u2009kV; capillary temperature, 300\u2009\u00b0C; S-lens RF level, 45; maximum injection time, 500\u2009ms; AGC target, 3\u2009\u00d7\u2009106.<\/p>\n Raw data were converted to mzXML format using msConvert and analysed in El-Maven (Elucidata) for targeted metabolite identification based on accurate mass and retention time, using an in-house standard library. Data were normalized to protein content and analysed in MetaboAnalyst 6.0 (https:\/\/www.metaboanalyst.ca<\/a>).<\/p>\n GSH measurements<\/p>\n Cells (5,000 per well) were seeded into 96-well plates, and GSH levels were assessed using the GSH\/GSSG-Glo assay (Promega, V6611). Parallel cell viability assessments were used for data normalization.<\/p>\n Seahorse assay<\/p>\n Cells (5,000 per well) were seeded in 96-well plates and analysed using the Seahorse XF24 system. Oxygen consumption rates were measured sequentially after oligomycin (1\u2009\u03bcM), FCCP (1\u2009\u03bcM) and rotenone\/antimycin A (0.5\u2009\u03bcM each). Data were normalized to protein content.<\/p>\n s.c. and i.n. tumour models<\/p>\n Mice were housed under sterile conditions with sterilized standard chow and water provided ad libitum and maintained under a 12\u2009h\u201312\u2009h light\u2013dark cycle and 22\u2009\u00b1\u20092\u2009\u00b0C, 55\u2009\u00b1\u20095% humidity. Animals were allocated randomly to treatment groups, and the samples were processed in an arbitrary order. No formal randomization or blinding was applied. The maximum permitted tumour diameter of 2.0\u2009cm was not exceeded in any of the experiments. All procedures complied with institutional ethical guidelines and were approved by the Institutional Animal Care and Use Committee of the Harvard T.H. Chan School of Public Health (protocol IS00003460) or the Stanford University Institutional Animal Care and Use Committee (protocol APLAC-34518).<\/p>\n For s.c. injections, 2\u2009\u00d7\u2009105 B16-F10 WT Luc, B16-F10 Fsp1-KO Luc, or LN7 1134BL WT or Fsp1-KO cells were suspended in 100\u2009\u00b5l of DMEM without phenol red and injected into either the right or left flank of 6\u20138-week-old male or female C57BL\/6J or C57BL\/6N mice44<\/a>.<\/p>\n For i.n. injections, 1\u2009\u00d7\u2009104 SK-MEL5 or LN7 1134BL WT or Fsp1-KO cells were injected into the popliteal LN of 6\u20138-week-old NSG or C57BL\/6J mice. To visualize the lymphatics, 2% Evans Blue dye (Sigma-Aldrich, E2129) was injected into the footpad 5\u2009min before the procedure. Mice were injected with buprenorphine and anesthetized with isoflurane, and a 5\u201310\u2009mm incision was made in the region of the right popliteal LN. The node was identified by Evans Blue staining, immobilized with forceps and 1\u2009\u00d7\u2009104 cells in 10\u2009\u00b5l of 1\u00d7 PBS were injected into the LN using a 27\u2009G Hamilton syringe. Successful injection was confirmed by visible swelling of the node. Incisions were closed with surgical glue (VetBond Tissue Adhesive, 3M, 1469SB) and the mice were monitored for signs of pain or distress for 5\u2009days45<\/a>.<\/p>\n Once tumours were palpable in \u226550% of mice (around 1\u2009week after injection), 10\u2009\u00b5l of vehicle or drug solution was administered daily through intratumoural (i.n. or s.c.) injection into tumour-bearing sites. Treatment groups included: L-BSO (1\u2009mM; Thermo Fisher Scientific, 235520050), icFSP1 (0.025\u2009mg (2.5\u2009mg\u2009ml\u22121); Selleckchem, E1535), L-BSO + icFSP1 (1\u2009mM + 0.025\u2009mg (2.5\u2009mg\u2009ml\u22121)), viFSP1 (0.025\u2009mg (2.5\u2009mg\u2009ml\u22121); MedChemExpress, HY-163002), L-BSO + viFSP1 (1\u2009mM + 0.025\u2009mg (2.5\u2009mg\u2009ml\u22121)) and FSEN1 (0.025\u2009mg (2.5\u2009mg\u2009ml\u22121); MedChemExpress, HY-153629). L-BSO was dissolved in 0.9% sodium chloride (saline; Quality Biology, 114-055-101). icFSP1 was formulated in 55% PBS (Corning, VWR45000-430) and 45% PEG300 (MedChemExpress, HY-Y0873). viFSP1 and FSEN1 were formulated in 20% DMA, 40% PEG400 and 40% of 50% 2-hydroxypropyl-\u03b2-cyclodextrin (2HP\u03b2CD) in water.<\/p>\n Tumour diameters were measured daily using callipers until any tumour reached around 1.5\u2009cm in its largest dimension, which defined the experimental end point. At the end point, all of the mice in the cohort were euthanized in accordance with approved protocols. Tumour diameters and weights were recorded, and tissues were collected and frozen for downstream analyses.<\/p>\n Experimental lung metastasis was evaluated through intravenous delivery of cancer cells in the lateral tail vein of tumour-naive mice. A total of 2\u2009\u00d7\u2009106 LN7-1134BL WT or Fsp1-KO cells was resuspended in 200\u2009\u00b5l of DMEM without phenol red and injected into the lateral tail vein of 8-week-old female C57BL\/6N mice using a 27-gauge needle44<\/a>. Mice were euthanized 14\u2009days after injection, and the lungs were inflated with PBS using a 25-gauge needle inserted into the trachea, and the lungs were removed for visible counting of metastatic nodules identified by melanin.<\/p>\n For LN spontaneous metastasis assays, 2\u2009\u00d7\u2009105 LN7 1134BL WT or Fsp1-KO cells were suspended in 100\u2009\u00b5l DMEM (without phenol red) and injected s.c. into the right or left flank of 6\u20138-week-old male or female C57BL\/6J or C57BL\/6N mice. Mice were euthanized 24 days after injection and the draining LNs were collected and classified as metastatic (LN+) or non-metastatic (LN\u2212) based on the presence of melanin-containing melanoma cells44<\/a>.<\/p>\n Bioinformatics analysis<\/p>\n Correlation analyses used tools available online (https:\/\/hgserver1.amc.nl\/<\/a>). Metabolomic data were analysed using MetaboAnalyst 6.0 (https:\/\/www.metaboanalyst.ca\/<\/a>).<\/p>\n Joint pathway analysis transcriptomic and metabolomic datasets showing significant alterations (P\u2009<\u20090.05, |Fold Change|\u2009>\u20091) between parental (B16-F0) and LN (LN8) clones underwent joint pathway enrichment analysis using MetaboAnalyst. Parameters included integrated metabolic pathways, hypergeometric test, degree centrality topology and pathway-level P-value combination. Pathways were considered significant at P\u2009<\u20090.05 and impact\u2009>\u20090.2 (normalized degree centrality), with at least two significantly altered metabolites.<\/p>\n Correlation analysis gene\u2013metabolite correlations were calculated using the cor.test function (R stats package v.3.6.2). Analysis focused on highly interconnected genes and metabolites within the KEGG glutathione metabolism pathway modules (glutathione biosynthesis and ferroptosis protection), obtained using the MetaboSignal package (v.1.32.1) and the cluster_walktrap algorithm from the igraph package (v.2.0.2). Only late LN tumour generations were included due to sample size limitations.<\/p>\n Bayesian inference of directed acyclic graphs (DAGs) was used to identify cause\u2013effect networks among genes and metabolites across tumour generations (early: B16-F0, F018IL; late: LN7, LN8, LN9). DAG networks were inferred using the BiDAG package (v.2.1.4) with Bayesian Gaussian equivalent scoring and order Markov Chain Monte Carlo structure learning. Networks were averaged over 100 iterations to account for inference variability, assigning edge probabilities based on inference frequency.<\/p>\n Software for Illustrations<\/p>\n Illustrations were generated using FIJI (2.0.0-rc-69\/1.52n), Prism (10.5.0) and BioRender (http:\/\/biorender.com<\/a>). Figures created using BioRender include Figs. 1a<\/a>, 2c<\/a> and 5j<\/a> and Extended Data Figs. 7i<\/a> and 10a,b<\/a>.<\/p>\n Statistical analysis<\/p>\n Data are presented as mean\u2009\u00b1\u2009s.d. Statistical analyses were performed using GraphPad Prism v.10.5.0 (GraphPad Software) and included unpaired two-sided Student\u2019s t-tests with Welch\u2019s correction, one-way ANOVA with Dunnett\u2019s, Tukey\u2019s or \u0160id\u00e1k\u2019s multiple-comparisons tests, Kruskal\u2013Wallis tests followed by Dunn\u2019s post hoc test, log-rank (Mantel\u2013Cox) tests for survival analyses and contingency analysis using \u03c72 with Fisher\u2019s exact test. P\u2009<\u20090.05 was considered to be statistically significant. Sample sizes (n) refer to biological or technical replicates as defined in individual figure legends. Numbers independent biological replications are indicated in the figure legends, with the exception of Fig. 1<\/a>, for which replicates are noted here: for Fig 1e,g<\/a>, B16-F0 (n\u2009=\u200930), LN1-18IL (n\u2009=\u200930), LN7-1112AR (n\u2009=\u20099), LN7-1120BL (n\u2009=\u20099), LN7-1134BL (n\u2009=\u20099), LN8-1194BR (n\u2009=\u200912), LN8-1198AR (n\u2009=\u200912), LN8-1205BL (n\u2009=\u200912), LN9-1315BL (n\u2009=\u20096), LN9-1358IR (n\u2009=\u20096); Fig. 1f,h<\/a>, parental (n\u2009=\u200930), LN (n\u2009=\u200975); Fig. 1i<\/a>, B16-F0 (n\u2009=\u20097), LN1-18IL (n\u2009=\u20097), LN7-1112AR (n\u2009=\u20094), LN7-1120BL (n\u2009=\u20093), LN7-1134BL (n\u2009=\u20094), LN8-1194BR (n\u2009=\u20093), LN8-1198AR (n\u2009=\u20093), LN8-1205BL (n\u2009=\u20093), LN9-1315BL (n\u2009=\u20097), LN9-1358IR (n\u2009=\u20097); Fig. 1j<\/a>, parental (n\u2009=\u20097), LN (n\u2009=\u200934); (k) B16-F0 (n\u2009=\u200915), LN1-18IL (n\u2009=\u200915), LN7-1112AR (n\u2009=\u20096), LN7-1120BL (n\u2009=\u20096), LN7-1134BL (n\u2009=\u20096), LN8-1194BR (n\u2009=\u20096), LN8-1198AR (n\u2009=\u20096), LN8-1205BL (n\u2009=\u20096), LN9-1315BL (n\u2009=\u20096), LN9-1358IR (n\u2009=\u20096); Fig. 1l<\/a>, parental (n\u2009=\u200915), LN (n\u2009=\u200948).<\/p>\n Reporting summary<\/p>\n