{"id":587298,"date":"2026-04-16T07:22:14","date_gmt":"2026-04-16T07:22:14","guid":{"rendered":"https:\/\/www.newsbeep.com\/us\/587298\/"},"modified":"2026-04-16T07:22:14","modified_gmt":"2026-04-16T07:22:14","slug":"ebv-strain-interacts-with-host-hla-to-drive-nasopharyngeal-carcinoma-risk","status":"publish","type":"post","link":"https:\/\/www.newsbeep.com\/us\/587298\/","title":{"rendered":"EBV strain interacts with host HLA to drive nasopharyngeal carcinoma risk"},"content":{"rendered":"<p>Study participants<\/p>\n<p>Participants from southern China were enrolled through two independent recruitments (sample sets 1 and 2). Participants in sample set 1 were participants in a population-based case\u2013control study conducted in NPC-endemic regions of southern China (Guangdong and Guangxi provinces) between 2010 and 2014. The study design was previously described in detail<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 59\" title=\"Ye, W. et al. Development of a population-based cancer case&#x2013;control study in southern china. Oncotarget 8, 87073&#x2013;87085 (2017).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR59\" id=\"ref-link-section-d133833025e2335\" rel=\"nofollow noopener\" target=\"_blank\">59<\/a>. In brief, 2,554 treatment-naive patients histologically confirmed with NPC were identified through a rapid case ascertainment system involving a network of local physicians. For the population-based control recruitment, 2,648 healthy control\u00a0individuals were frequency-matched to cases by sex, 5-year age group and residential area, and were randomly selected from local population registries. Saliva DNA samples were available for 1,202 cases and 1,780 controls. In sample set 1, 747 patients with NPC and 1,251 healthy controls with age, sex, and available EBV genotype and host genome-wide genotyping were included in the discovery phase of the host genome-wide scan (Extended Data Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"figure anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Fig6\" rel=\"nofollow noopener\" target=\"_blank\">1<\/a>, Supplementary Table\u2009<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM3\" rel=\"nofollow noopener\" target=\"_blank\">1<\/a> and Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">2<\/a>). In sample set 2, an independent NPC case\u2013control study was recruited from the same Chinese population in southern China. This study consisted of 883 cases and 1,537 controls of self-reported Chinese ancestry recruited between 2013 and 2022. For sample set 2, 644 patients with NPC and 880 healthy participants with age, sex, and available EBV genotype and host genome-wide genotyping were included in the validation phase of host genome-wide interaction study (Extended Data Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"figure anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Fig6\" rel=\"nofollow noopener\" target=\"_blank\">1<\/a>, Supplementary Table\u2009<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM3\" rel=\"nofollow noopener\" target=\"_blank\">1<\/a> and Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">2<\/a>). All study participants were recruited irrespective of EBV strain status, and no selection was performed on the basis of infection with any specific EBV subtypes.<\/p>\n<p>The Singapore dataset was completely independently recruited in Singapore, comprising 226 cases with NPC and 209 controls. Among these, 223 cases with NPC and 204 healthy controls with available EBV genotype and HLA allele data were included in the replication of EBV subtype\u2013host interaction analysis (Extended Data Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"figure anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Fig6\" rel=\"nofollow noopener\" target=\"_blank\">1<\/a> and Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">4<\/a>).<\/p>\n<p>Furthermore, to capture EBV genomic diversity across China for viral population genetic and phylogenetic analysis, we enrolled 163 healthy participants from different regions of China, including northern China (Shandong, Shanxi, Inner Mongolia, Xinjiang, Hebei and Liaoning), eastern China (Fujian) and southwestern China (Sichuan). Among them, 113 EBV whole-genome sequences passed quality control (see details below) and were included in subsequent EBV phylogenetic analyses (Extended Data Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"figure anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Fig6\" rel=\"nofollow noopener\" target=\"_blank\">1<\/a>, Supplementary Table\u2009<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM3\" rel=\"nofollow noopener\" target=\"_blank\">16<\/a> and Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">7<\/a>).<\/p>\n<p>This study was approved by the institutional ethics committees of the Sun Yat-sen University Cancer Center, Guangzhou, China and the Genome Institute of Singapore, A*STAR, Singapore. Written informed consent was obtained from all participants.<\/p>\n<p>Sample collection and processing<\/p>\n<p>Saliva samples were collected into vials containing an equal volume of prepared lysis buffer (50\u2009mM Tris, pH 8.0, 50\u2009mM EDTA, 50\u2009mM sucrose, 100\u2009mM NaCl and 1% SDS) and stored at \u221280\u2009\u00b0C. DNA was extracted from saliva using either the Chemagic STAR (Hamilton Robotics) or the QIAamp DNA Blood Midi Kit (Qiagen) according to the manufacturer\u2019s instructions. The extracted DNA was subsequently used for human and EBV genotyping, as well as EBV whole-genome sequencing.<\/p>\n<p>Peripheral blood samples were collected and processed within 24\u2009h. Human peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll density gradient centrifugation, cryopreserved in liquid nitrogen and subsequently used for T cell functional assays.<\/p>\n<p>Data acquisition and processing<\/p>\n<p>The majority of the paired data used for the host\u2013EBV interaction analyses were newly generated in this study (Extended Data Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"figure anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Fig6\" rel=\"nofollow noopener\" target=\"_blank\">1<\/a>). For host genome genotyping, all data used in the genome-wide interaction scan (n\u2009=\u20093,522) were generated for this study, comprising case\u2013control datasets for the host genome-wide interaction analysis with high-risk EBV status (step 1: 747 cases and 1,251 controls in discovery; and 644 cases and 880 controls in validation). For EBV whole-genome sequences, this study in total included 732 newly sequenced EBV genomes, together with 1,354 EBV genomes from NCBI databases. The EBV genome-wide interaction fine-mapping was conducted in the paired host\u2013EBV genome dataset (n\u2009=\u2009734), within which 154 out of 734 EBV genomes were previously deposited in the NCBI in our earlier work<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 6\" title=\"Xu, M. et al. Genome sequencing analysis identifies Epstein&#x2013;Barr virus subtypes associated with high risk of nasopharyngeal carcinoma. Nat. Genet. 51, 1131&#x2013;1136 (2019).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR6\" id=\"ref-link-section-d133833025e2410\" rel=\"nofollow noopener\" target=\"_blank\">6<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 44\" title=\"Zhang, X. et al. Out-of-Africa migration and clonal expansion of a recombinant Epstein&#x2013;Barr virus drives frequent nasopharyngeal carcinoma in southern China. Natl Sci. Rev. 12, nwae438 (2025).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR44\" id=\"ref-link-section-d133833025e2413\" rel=\"nofollow noopener\" target=\"_blank\">44<\/a>.<\/p>\n<p>Genotyping and quality control of human genetic variants<\/p>\n<p>Extracted DNA was used for human genotyping using the Asian Screening Array (ASA) Chip (Illumina) or OmniZhongHua-8 Chip (Illumina). The genotype data from participants with complete demographic information and EBV genotyping information (BALF2-CCT SNPs 162215A&gt;C, 162476T&gt;C and 163364C&gt;T) were subjected to sample and genotype quality control, as detailed below (see workflow and detailed quality control metrics in Supplementary Table\u2009<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM3\" rel=\"nofollow noopener\" target=\"_blank\">3<\/a> and Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">2<\/a>). Genotype quality control was performed using PLINK (v1.9)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 60\" title=\"Chang, C. C. et al. Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience 4, 7 (2015).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR60\" id=\"ref-link-section-d133833025e2430\" rel=\"nofollow noopener\" target=\"_blank\">60<\/a>. Samples were excluded based on the following criteria: (1) overall variant call rate\u2009\u2264\u200992%, (2) heterozygosity rate deviating beyond\u2009\u00b1\u20093 standard deviations from the mean, or (3) relatedness\u2009&gt;\u200920%. Variants were removed if they demonstrated: (1) call rate\u2009\u2264\u200995%, (2) minor allele frequency (MAF)\u2009\u2264\u20095%, or (3) significant deviation from Hardy\u2013Weinberg equilibrium with thresholds of P\u2009&lt;\u20091\u2009\u00d7\u200910\u22126 in controls and P\u2009&lt;\u20091\u2009\u00d7\u200910\u221210 in cases. To detect population outliers and stratification, a MDS approach was employed using either the samples from this study alone or in combination with reference samples from the 1000 Genomes Project (<a href=\"http:\/\/www.1000genomes.org\/\" rel=\"nofollow noopener\" target=\"_blank\">http:\/\/www.1000genomes.org\/<\/a>)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 61\" title=\"The 1000 Genomes Project Consortium.&#xA0;A global reference for human genetic variation. Nature 526, 68&#x2013;74 (2015).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR61\" id=\"ref-link-section-d133833025e2452\" rel=\"nofollow noopener\" target=\"_blank\">61<\/a>, as illustrated in Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">3<\/a>. Following quality control, 1,998 participants from sample set 1, and 1,524 participants from sample set 2 were used for further analysis (Extended Data Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"figure anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Fig6\" rel=\"nofollow noopener\" target=\"_blank\">1<\/a>, Supplementary Table\u2009<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM3\" rel=\"nofollow noopener\" target=\"_blank\">3<\/a> and Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">2<\/a>).<\/p>\n<p>HLA imputation and HLA typing<\/p>\n<p>Following quality control of the human genotype data, variants within the HLA region (chromosome 6: 25000000\u201335000000, GRCh37\/hg19) were extracted for imputation. HLA region imputation was conducted using SNP2HLA<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 23\" title=\"Jia, X. et al. Imputing amino acid polymorphisms in human leukocyte antigens. PLoS ONE 8, e64683 (2013).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR23\" id=\"ref-link-section-d133833025e2477\" rel=\"nofollow noopener\" target=\"_blank\">23<\/a> with the Pan-Asian reference panel<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 24\" title=\"Okada, Y. et al. Risk for ACPA-positive rheumatoid arthritis is driven by shared HLA amino acid polymorphisms in Asian and European populations. Hum. Mol. Genet. 23, 6916&#x2013;6926 (2014).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR24\" id=\"ref-link-section-d133833025e2481\" rel=\"nofollow noopener\" target=\"_blank\">24<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 25\" title=\"Pillai, N. E. et al. Predicting HLA alleles from high-resolution SNP data in three Southeast Asian populations. Hum. Mol. Genet. 23, 4443&#x2013;4451 (2014).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR25\" id=\"ref-link-section-d133833025e2484\" rel=\"nofollow noopener\" target=\"_blank\">25<\/a>. Post-imputation filtering retained variants with INFO\u2009&gt;\u20090.5\u00a0(INFO is\u00a0an imputation quality metric indicating the reliability of imputed genotypes) and MAF\u2009&gt;\u20095% (Supplementary Table\u2009<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM3\" rel=\"nofollow noopener\" target=\"_blank\">4<\/a> and Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">2<\/a>). HLA fine-mapping results were visualized using the code proposed by Raychaudhuri et al.<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 62\" title=\"Luo, Y. et al. A high-resolution HLA reference panel capturing global population diversity enables multi-ancestry fine-mapping in HIV host response. Nat. Genet. 53, 1504&#x2013;1516 (2021).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR62\" id=\"ref-link-section-d133833025e2494\" rel=\"nofollow noopener\" target=\"_blank\">62<\/a>.<\/p>\n<p>To validate the accuracy of HLA imputation derived from our human genotype data, we performed high-resolution HLA typing on a randomly selected subset of 732 successfully imputed samples from sample set 2. In brief, genomic DNA was sheared to approximately 150\u2013200\u2009bp, followed by end-repair and adaptor ligation to construct sequencing libraries. Targeted enrichment of HLA loci was performed using the commercially available TargetSeq Human HLA Panel (iGeneTech). The enriched libraries were sequenced on the Illumina NovaSeq 6000 platform with 150-bp paired-end reads. Sequence data were processed using HLA-HD (v1.2.0)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 63\" title=\"Kawaguchi, S., Higasa, K., Shimizu, M., Yamada, R. &amp; Matsuda, F. HLA-HD: an accurate HLA typing algorithm for next-generation sequencing data. Hum. Mutat. 38, 788&#x2013;797 (2017).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR63\" id=\"ref-link-section-d133833025e2501\" rel=\"nofollow noopener\" target=\"_blank\">63<\/a> for high-resolution HLA typing. Comparative analysis against HLA typing data in 732 samples demonstrated allele-level concordance rates of 92.9% at HLA-A, 88.5% at HLA-B, 95.9% at HLA-C, 88.9% at HLA-DQB1, 87.5% at HLA-DPB1 and 83.8% at HLA-DRB1 loci for the imputation approach.<\/p>\n<p>EBV whole-genome sequencing, variant calling and principal component analysis<\/p>\n<p>We first quantified EBV DNA in each sample by real-time PCR, targeting a fragment of the BALF5 gene (5\u2032 primer: GGTCACAATCTCCACGCTGA; 3\u2032 primer: CAACGAGGCTGACCTGATCC). Samples with an EBV cycle threshold (Ct) value below 31 were selected for subsequent EBV whole-genome sequencing (WGS), as EBV DNA with Ct values above 31 was insufficient for successful WGS (Supplementary Figs. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">4<\/a> and <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">7<\/a>).<\/p>\n<p>Saliva DNA was prepared following the NadPrep EZ DNA Library Preparation Protocol (v2.2). In brief, DNA was fragmented, purified, end blunted, adaptor ligated and then amplified. The DNA libraries were subjected to hybrid capture using the EBV-targeting single-stranded DNA probes developed by Integrated DNA Technologies. After capture enrichment using the Nanodigmbio Hybridization Capture of DNA Libraries Protocol (v1.0), libraries were sequenced (paired-end 150\u2009bp) using the Illumina NextSeq 500 platform.<\/p>\n<p>Raw reads were trimmed and filtered using fastp<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 64\" title=\"Chen, S., Zhou, Y., Chen, Y. &amp; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34, i884&#x2013;i890 (2018).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR64\" id=\"ref-link-section-d133833025e2525\" rel=\"nofollow noopener\" target=\"_blank\">64<\/a>. The processed paired-end reads were aligned to the EBV B95-8 reference genome (RefSeq accession no. <a href=\"https:\/\/www.ncbi.nlm.nih.gov\/nuccore\/NC_007605.1\" rel=\"nofollow noopener\" target=\"_blank\">NC_007605.1<\/a>) using the Burrows\u2013Wheeler Aligner (v0.7.17)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 65\" title=\"Li, H. &amp; Durbin, R. Fast and accurate short read alignment with Burrows&#x2013;Wheeler transform. Bioinformatics 25, 1754&#x2013;1760 (2009).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR65\" id=\"ref-link-section-d133833025e2536\" rel=\"nofollow noopener\" target=\"_blank\">65<\/a>. Duplicated reads were removed by Picard (v2.18.14)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 66\" title=\"Broad Institute. Picard tools (accessed 13 September 2018); &#010;                https:\/\/broadinstitute.github.io\/picard\/&#010;                &#010;              .\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR66\" id=\"ref-link-section-d133833025e2540\" rel=\"nofollow noopener\" target=\"_blank\">66<\/a>. Samples with insufficient sequencing coverage (less than 90% coverage at 30\u00d7 depth) or multiple EBV infections were excluded. Multiple infections were defined as samples with more than 10% biallelic or multi-allelic variants. In addition, VerifyBamID (v1.1.3)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 67\" title=\"Jun, G. et al. Detecting and estimating contamination of human DNA samples in sequencing and array-based genotype data. Am. J. Hum. Genet. 91, 839&#x2013;848 (2012).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR67\" id=\"ref-link-section-d133833025e2544\" rel=\"nofollow noopener\" target=\"_blank\">67<\/a> was used to detect mixed infections, using a cut-off (Chipmix\u2009&gt;\u20090.01681) determined from the average Chipmix values for simulated 1.5% mixed infections. A total of 734 samples (324 patients with NPC and 410 healthy donors) with available host genome information in sample sets 1 and 2 passed the EBV genome quality control criteria and were included in genome-wide EBV\u2013HLA interaction analyses.<\/p>\n<p>Following the GATK best practice workflows (v4.1.8.1), variants were identified after base quality score recalibration<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 68\" title=\"DePristo, M. A. et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat. Genet. 43, 491&#x2013;498 (2011).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR68\" id=\"ref-link-section-d133833025e2551\" rel=\"nofollow noopener\" target=\"_blank\">68<\/a>. To avoid inaccurate calling, we removed low-quality variants using GATK recommended hard-filtering thresholds (threshold for SNPs: \u2018QD\u2009&lt;\u20092.0\u2019, \u2018QUAL\u2009&lt;\u200930.0\u2019, \u2018SOR\u2009&gt;\u20093.0\u2019, \u2018FS\u2009&gt;\u200960.0\u2019, \u2018MQ\u2009&lt;\u200940.0\u2019, \u2018MQRankSum\u2009&lt;\u2009\u221212.5\u2019 and \u2018ReadPosRankSum\u2009&lt;\u2009\u22128.0\u2019; threshold for indels: \u2018QD\u2009&lt;\u20092.0\u2019, \u2018QUAL\u2009&lt;\u200930.0\u2019, \u2018FS\u2009&gt;\u2009200.0\u2019 and \u2018ReadPosRankSum\u2009&lt;\u2009\u221220.0\u2019). After filtering for missingness\u2009&lt;\u200910% and MAF\u2009&gt;\u200910%, 1,942 variants were retained for further analysis (Supplementary Table\u2009<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM3\" rel=\"nofollow noopener\" target=\"_blank\">9<\/a> and Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">4<\/a>). Moreover, in the genome-wide EBV\u2013HLA interaction analysis, stratification was performed based on disease status and the investigated HLA-A allele, and only EBV variants with MAF\u2009&gt;\u20095% in each stratum were included in the analysis. The functional annotation of the EBV variants was performed using the SNPEff package (v5.0e) according to the reference genome (<a href=\"https:\/\/www.ncbi.nlm.nih.gov\/nuccore\/NC_007605.1\" rel=\"nofollow noopener\" target=\"_blank\">NC_007605.1<\/a>, NCBI annotation, November 2013)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 69\" title=\"Cingolani, P. et al. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly 6, 80&#x2013;92 (2012).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR69\" id=\"ref-link-section-d133833025e2568\" rel=\"nofollow noopener\" target=\"_blank\">69<\/a>.<\/p>\n<p>In the genome-wide EBV\u2013HLA interaction analysis, EBV principal components were incorporated as covariates to adjust for viral population stratification. For principal component analysis (PCA), variants were filtered based on MAF\u2009&gt;\u200910% and linkage disequilibrium pruning with a pairwise correlation r2\u2009&gt;\u20090.5 within a 1,000-SNP sliding window with a 5-SNP step size. PCA was performed using PLINK (v1.9)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 60\" title=\"Chang, C. C. et al. Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience 4, 7 (2015).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR60\" id=\"ref-link-section-d133833025e2580\" rel=\"nofollow noopener\" target=\"_blank\">60<\/a>.<\/p>\n<p>Genotyping of EBV variants by MassArray iPLEX<\/p>\n<p>EBV genotypes, including the BALF2-CCT subtype SNPs 162215A&gt;C, 162476T&gt;C and 163364C&gt;T, were determined using customized primers and the Agena Bioscience MassArray iPLEX platform, following the manufacturer\u2019s protocol, for sample sets 1 and 2 (refs. <a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 6\" title=\"Xu, M. et al. Genome sequencing analysis identifies Epstein&#x2013;Barr virus subtypes associated with high risk of nasopharyngeal carcinoma. Nat. Genet. 51, 1131&#x2013;1136 (2019).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR6\" id=\"ref-link-section-d133833025e2593\" rel=\"nofollow noopener\" target=\"_blank\">6<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 70\" title=\"Zhou, X. et al. A comprehensive risk score for effective risk stratification and screening of nasopharyngeal carcinoma. Nat. Commun. 12, 5189 (2021).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR70\" id=\"ref-link-section-d133833025e2596\" rel=\"nofollow noopener\" target=\"_blank\">70<\/a>). Using Agena Bioscience MassArray iPLEX platform, 37 EBV markers were genotyped for viral lineage inference, including BALF2-CCT SNPs 162215A&gt;C, 162476T&gt;C and 163364C&gt;T, EBER2 SNP 7048A&gt;C and EBNA3B SNP 84414G&gt;T, in 406 cases and 597 controls from sample set 1 (see Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM3\" rel=\"nofollow noopener\" target=\"_blank\">19<\/a>). Imputation of SNP 85841 was performed using Beagle (v5.4)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 71\" title=\"Browning, B. L., Zhou, Y. &amp; Browning, S. R. A one-penny imputed genome from next-generation reference panels. Am. J. Hum. Genet. 103, 338&#x2013;348 (2018).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR71\" id=\"ref-link-section-d133833025e2603\" rel=\"nofollow noopener\" target=\"_blank\">71<\/a>, with a reference panel of 667 southern China EBV genomes (734 total, excluding 67 used for imputation accuracy evaluation). Among 67 samples with both EBV genotyping and WGS data, the imputation accuracy for SNP 85841 reached 94.03%.<\/p>\n<p>Stepwise human\u2013EBV genome-wide interaction analysis<\/p>\n<p>The near-universal prevalence and large genome size of EBV pose major challenges for genome-to-genome interaction analyses, as adequately powered case\u2013control studies would require prohibitively large samples with paired host\u2013viral genomes. To address these limitations, we applied a stepwise analytical framework. In step 1, we scanned the human genome to identify variants showing interaction signals with the high-risk EBV subtype. In step 2, we fine-mapped the EBV genome to pinpoint viral variants driving the observed human\u2013EBV interactions.<\/p>\n<p>We adopted an approach for genome-wide interaction analysis recently developed by Zhu et al.<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 21\" title=\"Zhu, X. et al. An approach to identify gene&#x2013;environment interactions and reveal new biological insight in complex traits. Nat. Commun. 15, 3385 (2024).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR21\" id=\"ref-link-section-d133833025e2619\" rel=\"nofollow noopener\" target=\"_blank\">21<\/a>. This method uses two logistic regression models: one to estimate the overall genetic effects, and the other to estimate the interaction-independent genetic effects. By testing the difference between the overall genetic effect and the genetic effect excluding interaction, it allows robust detection of genome\u2009\u00d7\u2009EBV interaction effects. This stepwise genome-wide interaction analysis is detailed as follows.<\/p>\n<p>Step 1: host genome-wide scan for interaction with the high-risk EBV<\/p>\n<p>In this step, we tested whether the high-risk EBV subtype interacts with host genetic variants (additive coding) to influence NPC susceptibility. To evaluate this interaction, we calculated the difference between the overall and interaction-independent genetic effects, which is theoretically equivalent to testing the combined effect of genome\u2009\u00d7\u2009EBV interaction and mediation<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 21\" title=\"Zhu, X. et al. An approach to identify gene&#x2013;environment interactions and reveal new biological insight in complex traits. Nat. Commun. 15, 3385 (2024).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR21\" id=\"ref-link-section-d133833025e2630\" rel=\"nofollow noopener\" target=\"_blank\">21<\/a>. To disentangle interaction from mediation, we evaluated the association between genome and EBV and found no evidence of genetic mediation at a genome-wide significance threshold of 5\u2009\u00d7\u200910\u22127 (Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">10<\/a>). Thus, statistically significant loci identified in this analysis were interpreted as showing interaction effects.<\/p>\n<p>In a human genome-wide scan for the interaction effects with high-risk EBV subtype, a GWAS on NPC was conducted to examine the genetic (G) contribution to NPC (Y) using a logistic regression model, adjusting for covariates (C) such as sex, age and the first four host MDS components to account for population structure:<\/p>\n<p>$${\\rm{l}}{\\rm{o}}{\\rm{g}}{\\rm{i}}{\\rm{t}}\\{P(Y=1|G,C)\\}={\\alpha }_{0}+{\\alpha }_{1}G+{\\alpha }_{2}^{{\\prime} }C$$<\/p>\n<p>\n                    (1)\n                <\/p>\n<p>Here, \\({\\alpha }_{1}\\) represents the overall effect of G. Then, a genome-wide G\u2009\u00d7\u2009EBV interaction analysis on NPC risk was modelled through the following logistic regression:<\/p>\n<p>$$\\text{logit}\\{P(Y=1|G,\\text{EBV},C)\\}={\\beta }_{0}+{\\beta }_{1}G+{\\beta }_{2}\\text{EBV}+{\\beta }_{3}G\\times \\text{EBV}+{\\beta }_{4}^{{\\prime} }C$$<\/p>\n<p>\n                    (2)\n                <\/p>\n<p>In this model, \\({\\beta }_{1}\\) and \\({\\beta }_{3}\\) correspond to the interaction-independent effect of G to differentiate from the overall genetic effect \\({\\alpha }_{1}\\) in equation (<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"equation anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Equ1\" rel=\"nofollow noopener\" target=\"_blank\">1<\/a>) and the interaction effect of G\u2009\u00d7\u2009EBV, respectively. The terms G, EBV and G\u2009\u00d7\u2009EBV represent the host genotype, the infection of EBV subtype and their interaction, respectively.<\/p>\n<p>Then, we tested the G\u2009\u00d7\u2009EBV interaction by the method proposed by Zhu et al.<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 21\" title=\"Zhu, X. et al. An approach to identify gene&#x2013;environment interactions and reveal new biological insight in complex traits. Nat. Commun. 15, 3385 (2024).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR21\" id=\"ref-link-section-d133833025e3048\" rel=\"nofollow noopener\" target=\"_blank\">21<\/a>:<\/p>\n<p>$${T}_{\\text{interaction}}=\\frac{{(\\hat{{\\alpha }_{1}}-\\hat{\\theta }\\times \\hat{{\\beta }_{1}})}^{2}}{{\\rm{v}}{\\rm{a}}{\\rm{r}}(\\hat{{\\alpha }_{1}}-\\hat{\\theta }\\times \\hat{{\\beta }_{1}})}\\sim {X}_{1}^{2}$$<\/p>\n<p>\n                    (3)\n                <\/p>\n<p>where \\(\\theta \\) reflects the contribution of interaction-independent effect to overall effect. We estimated the causal effect \\(\\theta \\) by conducting a linear regression model that assessed the normalized interaction-independent effect\u2019s contribution to the normalized overall effect, denoting as \\(\\widehat{\\theta }\\):<\/p>\n<p>$$\\frac{\\hat{{\\alpha }_{1}}}{\\text{se}(\\hat{{\\alpha }_{1}})\\times \\sqrt{n}}={\\theta }_{0}+\\theta \\frac{\\hat{{\\beta }_{1}}}{\\text{se}(\\hat{{\\beta }_{1}})\\times \\sqrt{n}}+{\\epsilon }$$<\/p>\n<p>\n                    (4)\n                <\/p>\n<p>where \\(n\\) is the sample size, and \\({\\epsilon }\\) is the random noise. In the host genome study, \\(\\theta \\) in equation (<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"equation anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Equ4\" rel=\"nofollow noopener\" target=\"_blank\">4<\/a>) was estimated by all host genetic variants. The genetic variants without G\u2009\u00d7\u2009EBV interaction will fall on the regression line but the variants with G\u2009\u00d7\u2009EBV interaction will depart from this line. Therefore, we searched the host genetic variants that deviate from this regression line to test the effect of G\u2009\u00d7\u2009EBV interaction.<\/p>\n<p>Host genome-wide interaction analysis was conducted using the iterative Mendelian randomization and pleiotropy (IMRP) approach<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 72\" title=\"Zhu, X., Li, X., Xu, R. &amp; Wang, T. An iterative approach to detect pleiotropy and perform Mendelian randomization analysis using GWAS summary statistics. Bioinformatics 37, 1390&#x2013;1400 (2021).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR72\" id=\"ref-link-section-d133833025e3505\" rel=\"nofollow noopener\" target=\"_blank\">72<\/a>. The statistic \\({T}_{\\mathrm{interaction}}\\) in equation (<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"equation anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Equ3\" rel=\"nofollow noopener\" target=\"_blank\">3<\/a>) provides a statistical assessment of the significance of G\u2009\u00d7\u2009EBV interaction effects. To account for the effect of sample overlapping between the GWAS and interaction analysis, the IMRP method incorporated a correlation coefficient of standardized \\({\\alpha }_{1}\\) and \\({\\beta }_{1}\\), calculated from genome-wide variants lacking significant associations (P\u2009&gt;\u20090.05). Following causal effect \\(\\theta \\) estimation, a genome-wide interaction test, conceptually analogous to pleiotropy testing in IMRP, was applied. The quantile\u2013quantile plot indicates effective control of type 1 error in human genome-wide interaction analysis (Extended Data Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"figure anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Fig7\" rel=\"nofollow noopener\" target=\"_blank\">2a\u2013c<\/a>). For conditional analyses, the GWAS and interaction analyses were performed by incorporating the top variant and the EBV\u2013interaction term as covariates in two logistic regression models.<\/p>\n<p>Step 2: EBV genome-wide scan for interaction with HLA-A*11:01<\/p>\n<p>In this step, we tested whether EBV variants (binary coding) interact with HLA-A*11:01 (presence or absence) to influence NPC risk. To evaluate this interaction, an EBV GWAS was conducted to examine the EBV variant (GEBV) contribution to NPC (Y) using a generalized linear mixed model. Specifically, to control for viral population structure, we constructed a viral genetic relatedness matrix (vGRM) from EBV variants after linkage disequilibrium-based pruning (sliding window of 1,000 SNPs, step of 1 SNP, r2\u2009&lt;\u20090.4) using the GEMMA software (v0.98.5)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 73\" title=\"Zhou, X. &amp; Stephens, M. Genome-wide efficient mixed-model analysis for association studies. Nat. Genet. 44, 821&#x2013;824 (2012).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR73\" id=\"ref-link-section-d133833025e3613\" rel=\"nofollow noopener\" target=\"_blank\">73<\/a>, following the recommended practice and previous work on highly linked genomes<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 6\" title=\"Xu, M. et al. Genome sequencing analysis identifies Epstein&#x2013;Barr virus subtypes associated with high risk of nasopharyngeal carcinoma. Nat. Genet. 51, 1131&#x2013;1136 (2019).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR6\" id=\"ref-link-section-d133833025e3618\" rel=\"nofollow noopener\" target=\"_blank\">6<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 74\" title=\"Jiang, L. et al. A resource-efficient tool for mixed model association analysis of large-scale data. Nat. Genet. 51, 1749&#x2013;1755 (2019).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR74\" id=\"ref-link-section-d133833025e3621\" rel=\"nofollow noopener\" target=\"_blank\">74<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 75\" title=\"Yang, J., Lee, S. H., Goddard, M. E. &amp; Visscher, P. M. GCTA: a tool for genome-wide complex trait analysis. Am. J. Hum. Genet. 88, 76&#x2013;82 (2011).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR75\" id=\"ref-link-section-d133833025e3624\" rel=\"nofollow noopener\" target=\"_blank\">75<\/a>. We also performed sensitivity analyses using alternative linkage disequilibrium-pruning threshold r2\u2009&lt;\u20090.3 or 0.6, and the top-ranked interaction signal for EBV 85841G remained unchanged. We then fit a logistic mixed model in the GMMAT software (v1.4.2)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 76\" title=\"Chen, H. et al. Control for population structure and relatedness for binary traits in genetic association studies via logistic mixed models. Am. J. Hum. Genet. 98, 653&#x2013;666 (2016).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR76\" id=\"ref-link-section-d133833025e3632\" rel=\"nofollow noopener\" target=\"_blank\">76<\/a>, using this vGRM as a random effect (Z) and including age, sex, the top four viral principal components and the top four host MDS components as fixed effects (C) to account for viral and host population structure (equation \u00a0(<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"equation anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Equ5\" rel=\"nofollow noopener\" target=\"_blank\">5<\/a>)):<\/p>\n<p>$$\\text{logit}\\{P(Y=1|{G}_{\\text{EBV}},C,Z)\\}={\\alpha }_{0}^{\\text{EBV}}+{\\alpha }_{1}^{\\text{EBV}}{G}_{\\text{EBV}}+{{\\alpha }_{2}^{\\text{EBV}}}^{{\\prime} }C+Z$$<\/p>\n<p>\n                    (5)\n                <\/p>\n<p>Here \\({\\alpha }_{1}^{\\mathrm{EBV}}\\) represents the overall effect of GEBV. The random effect Z was assumed to follow a multivariate normal distribution with mean zero and covariance matrix proportional to the viral genetic relatedness matrix, that is, \\(Z \\sim N(0,{\\sigma }_{\\mathrm{EBV}}^{2}\\mathrm{vGRM})\\), to account for genome-wide EBV genetic similarity among samples. Then, a viral genome-wide GEBV\u2009\u00d7\u2009HLA interaction analysis on NPC risk was modelled through the following logistic mixed model:<\/p>\n<p>$$\\begin{array}{l}\\mathrm{logit}\\{P(Y\\,=\\,1|{G}_{\\mathrm{EBV}},\\mathrm{HLA},C,Z)\\}={\\beta }_{0}^{\\mathrm{EBV}}+{\\beta }_{1}^{\\mathrm{EBV}}{G}_{\\mathrm{EBV}}+{\\beta }_{2}^{\\mathrm{EBV}}\\mathrm{HLA}\\\\ \\,+\\,{\\beta }_{3}^{\\mathrm{EBV}}{G}_{\\mathrm{EBV}}\\times \\mathrm{HLA}+{{\\beta }_{4}^{\\mathrm{EBV}}}^{{\\prime} }C+Z\\end{array}$$<\/p>\n<p>\n                    (6)\n                <\/p>\n<p>In equation (<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"equation anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Equ6\" rel=\"nofollow noopener\" target=\"_blank\">6<\/a>), \\({\\beta }_{1}^{\\mathrm{EBV}}\\) and \\({\\beta }_{3}^{\\mathrm{EBV}}\\) correspond to the interaction-independent effect of GEBV to differentiate from the overall EBV effect \\({\\alpha }_{1}^{\\mathrm{EBV}}\\) in equation (<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"equation anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Equ5\" rel=\"nofollow noopener\" target=\"_blank\">5<\/a>) and the interaction effect of GEBV\u2009\u00d7\u2009HLA, respectively. The terms \\({G}_{\\mathrm{EBV}}\\), \\(\\mathrm{HLA}\\) and \\({G}_{\\mathrm{EBV}}\\times \\mathrm{HLA}\\) represent the EBV genotype, the HLA variant and their interaction, respectively.<\/p>\n<p>Then, we tested the GEBV\u2009\u00d7\u2009HLA interaction by the statistic proposed by Zhu et al.<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 21\" title=\"Zhu, X. et al. An approach to identify gene&#x2013;environment interactions and reveal new biological insight in complex traits. Nat. Commun. 15, 3385 (2024).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR21\" id=\"ref-link-section-d133833025e4189\" rel=\"nofollow noopener\" target=\"_blank\">21<\/a>:<\/p>\n<p>$${T}_{{\\rm{i}}{\\rm{n}}{\\rm{t}}{\\rm{e}}{\\rm{r}}{\\rm{a}}{\\rm{c}}{\\rm{t}}{\\rm{i}}{\\rm{o}}{\\rm{n}}}=\\frac{{\\left(\\hat{{\\alpha }_{1}^{\\text{EBV}}}-\\hat{{\\theta }^{\\text{EBV}}}\\times \\hat{{\\beta }_{1}^{{\\rm{E}}{\\rm{B}}{\\rm{V}}}}\\right)}^{2}}{{\\rm{v}}{\\rm{a}}{\\rm{r}}\\left(\\hat{{\\alpha }_{1}^{\\text{EBV}}}-\\hat{{\\theta }^{\\text{EBV}}}\\times \\hat{{\\beta }_{1}^{{\\rm{E}}{\\rm{B}}{\\rm{V}}}}\\right)}\\sim {X}_{1}^{2}$$<\/p>\n<p>\n                    (7)\n                <\/p>\n<p>where \\({\\theta }^{\\mathrm{EBV}}\\) reflects the contribution of interaction-independent effect to overall effect. We estimated the causal effect \\({\\theta }^{\\mathrm{EBV}}\\) by conducting a linear regression model that assesses the normalized interaction-independent effect\u2019s contribution to the normalized overall effect, denoting as \\(\\hat{{\\theta }^{\\mathrm{EBV}}}\\):<\/p>\n<p>$$\\frac{\\hat{{\\alpha }_{1}^{\\text{EBV}}}}{\\text{se}\\left(\\hat{{\\alpha }_{1}^{\\text{EBV}}}\\right)\\times \\sqrt{n}}={\\theta }_{0}^{\\text{EBV}}+{\\theta }^{\\text{EBV}}\\frac{\\hat{{\\beta }_{1}^{\\text{EBV}}}}{\\text{se}\\left(\\hat{{\\beta }_{1}^{\\text{EBV}}}\\right)\\times \\sqrt{n}}+{\\epsilon }$$<\/p>\n<p>\n                    (8)\n                <\/p>\n<p>where \\(n\\) is the sample size and \\({\\epsilon }\\) is the random noise. In the EBV genome study, \\({\\theta }^{\\mathrm{EBV}}\\) in equation (<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"equation anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Equ8\" rel=\"nofollow noopener\" target=\"_blank\">8<\/a>) was estimated using independent EBV variants, which were selected based on a linkage disequilibrium (r2) threshold of 0.3 across the whole EBV genome. We searched the EBV variants that deviate from this regression line to test the effect of GEBV\u2009\u00d7\u2009HLA interaction.<\/p>\n<p>The EBV genome interaction test was performed by the IMRP<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 72\" title=\"Zhu, X., Li, X., Xu, R. &amp; Wang, T. An iterative approach to detect pleiotropy and perform Mendelian randomization analysis using GWAS summary statistics. Bioinformatics 37, 1390&#x2013;1400 (2021).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR72\" id=\"ref-link-section-d133833025e4887\" rel=\"nofollow noopener\" target=\"_blank\">72<\/a>. The statistic \\({T}_{\\mathrm{interaction}}\\) in equation (<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"equation anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Equ7\" rel=\"nofollow noopener\" target=\"_blank\">7<\/a>) is a test for evaluating the effect of GEBV\u2009\u00d7\u2009HLA interaction. After estimating the causal effect \\({\\theta }^{\\mathrm{EBV}}\\), we performed the interaction test for all EBV variants. In the conditional analysis of the interaction test, the top EBV variant was included as covariates in two logistic mixed models.<\/p>\n<p>To control for multiple testing and type 1 error, we used the method previously presented<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 27\" title=\"Mbatchou, J., Abney, M. &amp; McPeek, M. S. BRASS: permutation methods for binary traits in genetic association studies with structured samples. PLoS Genet. 19, e1011020 (2023).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR27\" id=\"ref-link-section-d133833025e4936\" rel=\"nofollow noopener\" target=\"_blank\">27<\/a>. BRASS first fit a generalized linear mixed model that included host covariates (age, sex and host MDS components), viral principal components and vGRM to control the viral population structure and sample relatedness, excluding the viral SNP, host allele and their interaction (the null model). We computed the residuals and decorrelated them to obtain approximately exchangeable residuals. We then permuted these decorrelated residuals 10,000 times, and re-fit the interaction model on each replicate. This approach preserves the host\u2013viral relatedness structure and accounts for clonality and relatedness to the viral genome while breaking only the association of interest. Using the minimum P value across the EBV genome in each permutation, we set the empirical genome-wide threshold at \u03b1\u2009=\u20090.05, yielding an empirical genome-wide threshold of 5.92\u2009\u00d7\u200910\u22124 for the EBV interaction scan.<\/p>\n<p>Power simulation<\/p>\n<p>To quantify power under this stepwise design, we performed simulations following a previous method<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 77\" title=\"Kooperberg, C. &amp; Leblanc, M. Increasing the power of identifying gene x gene interactions in genome-wide association studies. Genet. Epidemiol. 32, 255&#x2013;263 (2008).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR77\" id=\"ref-link-section-d133833025e4954\" rel=\"nofollow noopener\" target=\"_blank\">77<\/a>. In step 1, we resampled the discovery dataset 1,000 times and simulated NPC case\u2013control status using the estimated main and interaction effects of the top interaction signal <a href=\"https:\/\/www.ncbi.nlm.nih.gov\/snp\/?term=rs417162\" rel=\"nofollow noopener\" target=\"_blank\">rs417162<\/a> (tagging HLA-A*11:01; r2\u2009=\u20090.73), high-risk EBV (BALF2-CCT) and their interaction. The power to rediscover the top interaction at the genome-wide significance threshold (P\u2009&lt;\u20095\u2009\u00d7\u200910\u22128) was 83%. In step 2, we randomly resampled individuals and their EBV genomes from the paired host\u2013EBV genome dataset and simulated NPC case\u2013control status using the estimated effects of HLA-A allele, EBV SNP 85841 and their interaction. Across 1,000 simulations, the power to detect the HLA-A allele\u2009\u00d7\u200985841G interaction at the Bonferroni-corrected significant threshold for the EBV genome scan was estimated. The power to detect the A*11:01\u2009\u00d7\u200985841G and A*02:07\u2009\u00d7\u200985841G interactions was 91% and 72%, respectively. The results of power calculations are consistent with previous human G\u2009\u00d7\u2009G power analyses and support that the stepwise design is statistically efficient under current sample-size realities<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" title=\"Kooperberg, C. &amp; Leblanc, M. Increasing the power of identifying gene x gene interactions in genome-wide association studies. Genet. Epidemiol. 32, 255&#x2013;263 (2008).\" href=\"#ref-CR77\" id=\"ref-link-section-d133833025e4975\">77<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" title=\"Kawaguchi, E. S., Kim, A. E., Lewinger, J. P. &amp; Gauderman, W. J. Improved two-step testing of genome-wide gene-environment interactions. Genet. Epidemiol. 47, 152&#x2013;166 (2023).\" href=\"#ref-CR78\" id=\"ref-link-section-d133833025e4975_1\">78<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" title=\"Wang, Z., Sul, J. H., Snir, S., Lozano, J. A. &amp; Eskin, E. Gene-gene interactions detection using a two-stage model. J. Comput. Biol. 22, 563&#x2013;576 (2015).\" href=\"#ref-CR79\" id=\"ref-link-section-d133833025e4975_2\">79<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 80\" title=\"Lin, D. Y. Evaluating statistical significance in two-stage genomewide association studies. Am. J. Hum. Genet. 78, 505&#x2013;509 (2006).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR80\" id=\"ref-link-section-d133833025e4978\" rel=\"nofollow noopener\" target=\"_blank\">80<\/a>.<\/p>\n<p>Relative excess risk and attributable fraction due to interactionRERI<\/p>\n<p>RERI quantifies the magnitude to which the joint effect of two factors (here HLA and EBV) exceeds the sum of their individual effects, providing population-level metrics essential for evaluating absolute risk differences in preventive interventions<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 28\" title=\"VanderWeele, T. J. &amp; Knol, M. J. A tutorial on interaction. Epidemiol. Methods 3, 33&#x2013;72 (2014).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR28\" id=\"ref-link-section-d133833025e4996\" rel=\"nofollow noopener\" target=\"_blank\">28<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 81\" title=\"Mathur, M. B. &amp; VanderWeele, T. J. R function for additive interaction measures. Epidemiology 29, e5&#x2013;e6 (2018).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR81\" id=\"ref-link-section-d133833025e4999\" rel=\"nofollow noopener\" target=\"_blank\">81<\/a>. The OR for NPC associated with the joint status of the presence of HLA risk variant (HLA\u2009=\u20091) and the high-risk EBV subtype (EBV\u2009=\u20091) was defined as \\({\\mathrm{OR}}_{11}\\). We estimated the interaction effect between the HLA variant and the EBV subtype infection on NPC risk as the relative excess RERI<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 28\" title=\"VanderWeele, T. J. &amp; Knol, M. J. A tutorial on interaction. Epidemiol. Methods 3, 33&#x2013;72 (2014).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR28\" id=\"ref-link-section-d133833025e5020\" rel=\"nofollow noopener\" target=\"_blank\">28<\/a>. We first fitted the following logistic regression model for NPC:<\/p>\n<p>$$\\text{logit}\\{P(Y=1|\\text{HLA},\\text{EBV},C)\\}={\\beta }_{0}+{\\beta }_{1}\\text{HLA}+{\\beta }_{2}\\text{EBV}+{\\beta }_{3}\\text{HLA}\\times \\text{EBV}+{\\beta }_{4}^{{\\prime} }C$$<\/p>\n<p>\n                    (9)\n                <\/p>\n<p>Here, \\(Y=\\mathrm{1,0}\\) represents the NPC case or control status, \\(\\mathrm{HLA}=\\mathrm{1,0}\\) indicates the presence or absence of HLA variant, and \\(\\mathrm{EBV}=\\mathrm{1,0}\\) denotes the presence or absence of EBV subtype, and \\(C\\) represents the set of covariates, as indicated in each table or figure legends. Because NPC is a rare disease, with an incidence of approximately 20 per 100,000 person-years in southern China<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 82\" title=\"Chen, W. J. et al. Impact of an Epstein&#x2013;Barr virus serology-based screening program on nasopharyngeal carcinoma mortality: a cluster-randomized controlled trial. J. Clin. Oncol. 43, 22&#x2013;31 (2025).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR82\" id=\"ref-link-section-d133833025e5257\" rel=\"nofollow noopener\" target=\"_blank\">82<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 83\" title=\"Zhang, L. F. et al. Incidence trend of nasopharyngeal carcinoma from 1987 to 2011 in Sihui County, Guangdong Province, South China: an age-period-cohort analysis. Chin. J. Cancer 34, 350&#x2013;357 (2015).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR83\" id=\"ref-link-section-d133833025e5260\" rel=\"nofollow noopener\" target=\"_blank\">83<\/a>, we used OR as an approximation of the relative risk in the interaction analyses. Under the rare outcome assumption, then<\/p>\n<p>$$\\text{RERI}\\,\\approx \\,{\\text{OR}}_{11}-{\\text{OR}}_{10}-{\\text{OR}}_{01}+1=\\exp ({\\beta }_{1}+{\\beta }_{2}+{\\beta }_{3})-\\exp {(\\beta }_{1})-\\exp {(\\beta }_{2})+1$$<\/p>\n<p>\n                    (10)\n                <\/p>\n<p>The 95% CI for the relative excess RERI was analysed using bootstrap resampling (5,000 iterations) implemented in the R package boot (v1.3.30) or delta method. The P value for the relative excess RERI was calculated using the method proposed by VanderWeele et al.<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 81\" title=\"Mathur, M. B. &amp; VanderWeele, T. J. R function for additive interaction measures. Epidemiology 29, e5&#x2013;e6 (2018).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR81\" id=\"ref-link-section-d133833025e5459\" rel=\"nofollow noopener\" target=\"_blank\">81<\/a>, which uses the low-risk genotype and low-risk exposure as the reference group and applies a one-tailed test.<\/p>\n<p>Attributable fraction due to interaction<\/p>\n<p>The attributable fraction due to interaction quantifies the proportion of disease risk, associated with a given exposure, that can be explained by its interaction with another factor. We estimated the proportion of HLA-associated risk that is attributable to its interaction with high-risk EBV strains (Extended Data Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"figure anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Fig7\" rel=\"nofollow noopener\" target=\"_blank\">2h<\/a>). The OR of NPC (Y\u2009=\u20091) associated with the joint status of HLA risk genotype (HLA\u2009=\u20091) and the high-risk EBV subtype (EBV\u2009=\u20091) was defined as \\({\\mathrm{OR}}_{11}\\), which was calculated with a logistic regression model of NPC status (Y) on the HLA variants (HLA), the EBV subtypes (EBV) and their interactions (HLA\u2009\u00d7\u2009EBV), adjusting for age, sex and the top four host MDS components. The NPC risk due to an HLA risk genotype was calculated with \\({\\mathrm{OR}}_{10}-1\\), whereas the NPC risk due to a high-risk EBV subtype was calculated with \\({\\mathrm{OR}}_{01}-1\\). The increased NPC risk due to the coexistence of both HLA risk genotype and high-risk EBV subtype was \\({\\mathrm{OR}}_{11}-1\\). The frequency of the high-risk EBV subtype in healthy controls is denoted as \\(P(\\mathrm{EBV}=1)\\), whereas the frequency of HLA risk genotype in healthy individuals is represented as \\(P(\\mathrm{HLA}=1)\\). Accordingly, the proportion of HLA-associated risk attributable to interaction was calculated as \\(\\frac{({\\mathrm{OR}}_{11}-{\\mathrm{OR}}_{10}-{\\mathrm{OR}}_{01}+1)P(\\mathrm{EBV}=1)}{({\\mathrm{OR}}_{10}-1)+({\\mathrm{OR}}_{11}-{\\mathrm{OR}}_{10}-{\\mathrm{OR}}_{01}+1)P(\\mathrm{EBV}=1)}\\)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 84\" title=\"VanderWeele, T. J. &amp; Tchetgen Tchetgen, E. J. Attributing effects to interactions. Epidemiology 25, 711&#x2013;722 (2014).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR84\" id=\"ref-link-section-d133833025e5756\" rel=\"nofollow noopener\" target=\"_blank\">84<\/a>. The 95% CI for the attributable fraction due to interaction was estimated via bootstrap resampling (5,000 iterations).<\/p>\n<p>Population attributable fraction and NPC incidence estimationPAF<\/p>\n<p>PAF estimates the attributable fraction for a binary outcome (here NPC Y\u2009=\u20091) under the hypothetical scenario where the risk factor (X) is eliminated from the population and corresponds to the attributable fraction of disease outcome explained by the risk factor. The PAFs explained by the effects of HLA-A alleles (presence or absence), EBV subtypes (presence or absence) or their combinations (Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"figure anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Fig4\" rel=\"nofollow noopener\" target=\"_blank\">4b,c<\/a>, Extended data Fig.\u2009<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"figure anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Fig7\" rel=\"nofollow noopener\" target=\"_blank\">2h<\/a> and Supplementary Tables <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM3\" rel=\"nofollow noopener\" target=\"_blank\">15<\/a> and <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM3\" rel=\"nofollow noopener\" target=\"_blank\">18<\/a>) were estimated using logistic regression models adjusting for covariates (C), including age, sex and the top four human MDS components, with the R package AF (v0.1.5)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 85\" title=\"Dahlqwist, E., Zetterqvist, J., Pawitan, Y. &amp; Sjolander, A. Model-based estimation of the attributable fraction for cross-sectional, case&#x2013;control and cohort studies using the R package AF. Eur. J. Epidemiol. 31, 575&#x2013;582 (2016).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR85\" id=\"ref-link-section-d133833025e5795\" rel=\"nofollow noopener\" target=\"_blank\">85<\/a>.<\/p>\n<p>$$\\text{logit}\\{P(Y\\,=\\,1|X,C)\\}={\\gamma }_{0}+{\\gamma }_{1}X+{\\gamma }_{2}^{{\\prime} }C$$<\/p>\n<p>\n                    (11)\n                <\/p>\n<p>In equation (<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"equation anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#Equ11\" rel=\"nofollow noopener\" target=\"_blank\">11<\/a>), \\({\\gamma }_{1}\\) corresponds to the effect of the risk factor (X; HLA-A alleles or EBV subtypes). Because NPC is a rare disease<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 82\" title=\"Chen, W. J. et al. Impact of an Epstein&#x2013;Barr virus serology-based screening program on nasopharyngeal carcinoma mortality: a cluster-randomized controlled trial. J. Clin. Oncol. 43, 22&#x2013;31 (2025).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR82\" id=\"ref-link-section-d133833025e5946\" rel=\"nofollow noopener\" target=\"_blank\">82<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 83\" title=\"Zhang, L. F. et al. Incidence trend of nasopharyngeal carcinoma from 1987 to 2011 in Sihui County, Guangdong Province, South China: an age-period-cohort analysis. Chin. J. Cancer 34, 350&#x2013;357 (2015).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR83\" id=\"ref-link-section-d133833025e5949\" rel=\"nofollow noopener\" target=\"_blank\">83<\/a>, the relative risk can be approximated by the OR. The attributable fraction of NPC explained by the risk factor can be approximated by<\/p>\n<p>$$\\text{AF}\\,\\approx \\,1-{E}_{C}\\{{\\text{OR}}^{-X}(C)|Y=1\\}$$<\/p>\n<p>\n                    (12)\n                <\/p>\n<p>NPC incidence estimation across EBV and HLA strata<\/p>\n<p>Age-standardized incidence rates (ASRs; per 100,000) for NPC in Asia were sourced from: (1) the 2020 China Cancer Registry Annual Report<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 86\" title=\"National Cancer Center. China Cancer Registry Annual Report 2020 (People&#x2019;s Medical Publishing House, 2022).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR86\" id=\"ref-link-section-d133833025e6048\" rel=\"nofollow noopener\" target=\"_blank\">86<\/a>, (2) the 2021 Hong Kong Cancer Registry<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 87\" title=\"Hong Kong Cancer Registry. Hospital Authority (accessed 26 January 2024); &#010;                www3.ha.org.hk\/cancereg&#010;                &#010;              .\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR87\" id=\"ref-link-section-d133833025e6052\" rel=\"nofollow noopener\" target=\"_blank\">87<\/a>, (3) the WHO International Agency for Research on Cancer databases<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 3\" title=\"Bray, F. et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 74, 229&#x2013;263 (2024).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR3\" id=\"ref-link-section-d133833025e6056\" rel=\"nofollow noopener\" target=\"_blank\">3<\/a>, and (4) peer-reviewed literature<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 88\" title=\"Lee, C. C. et al. Survival rate in nasopharyngeal carcinoma improved by high caseload volume: a nationwide population-based study in Taiwan. Radiat. Oncol. 6, 92 (2011).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR88\" id=\"ref-link-section-d133833025e6060\" rel=\"nofollow noopener\" target=\"_blank\">88<\/a>. HLA-A allele frequencies were obtained from three resources: our dataset, the NyuWa Genome Resource and published studies<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" title=\"Kwok, J. et al. High resolution allele genotyping and haplotype frequencies for NGS based HLA 11 loci of 5266 Hong Kong Chinese bone marrow donors. Hum. Immunol. 81, 577&#x2013;579 (2020).\" href=\"#ref-CR89\" id=\"ref-link-section-d133833025e6064\">89<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" title=\"Zhang, P. et al. NyuWa Genome resource: a deep whole-genome sequencing-based variation profile and reference panel for the Chinese population. Cell Rep. 37, 110017 (2021).\" href=\"#ref-CR90\" id=\"ref-link-section-d133833025e6064_1\">90<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" title=\"Ikeda, N. et al. Determination of HLA-A, -C, -B, -DRB1 allele and haplotype frequency in Japanese population based on family study. Tissue Antigens 85, 252&#x2013;259 (2015).\" href=\"#ref-CR91\" id=\"ref-link-section-d133833025e6064_2\">91<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 92\" title=\"Huang, Y. H. et al. A high-resolution HLA imputation system for the Taiwanese population: a study of the Taiwan Biobank. Pharmacogen. J. 20, 695&#x2013;704 (2020).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR92\" id=\"ref-link-section-d133833025e6067\" rel=\"nofollow noopener\" target=\"_blank\">92<\/a>. To evaluate population burden across strata defined by EBV strains and HLA-A background in southern China, we estimated stratum-specific NPC incidence and preventable cases. NPC incidence rates for each stratum were derived based on stratum-specific odds ratio to the overall regional NPC incidence of approximate 20 per 100,000 person-years<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 82\" title=\"Chen, W. J. et al. Impact of an Epstein&#x2013;Barr virus serology-based screening program on nasopharyngeal carcinoma mortality: a cluster-randomized controlled trial. J. Clin. Oncol. 43, 22&#x2013;31 (2025).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR82\" id=\"ref-link-section-d133833025e6072\" rel=\"nofollow noopener\" target=\"_blank\">82<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 83\" title=\"Zhang, L. F. et al. Incidence trend of nasopharyngeal carcinoma from 1987 to 2011 in Sihui County, Guangdong Province, South China: an age-period-cohort analysis. Chin. J. Cancer 34, 350&#x2013;357 (2015).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR83\" id=\"ref-link-section-d133833025e6075\" rel=\"nofollow noopener\" target=\"_blank\">83<\/a>, under the rare-disease approximation. We further translated the PAF into the estimated number of attributable cases under the counterfactual assumption<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 46\" title=\"Miettinen, O. S. Proportion of disease caused or prevented by a given exposure, trait or intervention. Am. J. Epidemiol. 99, 325&#x2013;332 (1974).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR46\" id=\"ref-link-section-d133833025e6079\" rel=\"nofollow noopener\" target=\"_blank\">46<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 47\" title=\"Mansournia, M. A. &amp; Altman, D. G. Population attributable fraction. Brit. Med. J. 360, k757 (2018).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR47\" id=\"ref-link-section-d133833025e6082\" rel=\"nofollow noopener\" target=\"_blank\">47<\/a> that exposure to high-risk EBV strains could be eliminated. For each stratum \\(i\\), preventable cases were computed as Preventable casesi\u2009=\u2009PAFi\u2009\u00d7\u2009CSouth, where CSouth\u2009=\u200951,000\u2009\u00d7\u20090.80 reflects an annual national NPC burden of approximately 51,000 cases<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 93\" title=\"Han, B. et al. Cancer incidence and mortality in China, 2022. J. Natl Cancer Cent. 4, 47&#x2013;53 (2024).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR93\" id=\"ref-link-section-d133833025e6115\" rel=\"nofollow noopener\" target=\"_blank\">93<\/a> and approximately 80% occurring in southern China.<\/p>\n<p>Peptide\u2013HLA-binding assayPrediction of HLA-A allele-binding affinity<\/p>\n<p>Peptide\u2013HLA-A*11:01-binding or A*02:07-binding affinities were predicted by NetMHCpan 4.1 (ref. <a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 35\" title=\"Reynisson, B., Alvarez, B., Paul, S., Peters, B. &amp; Nielsen, M. NetMHCpan-4.1 and NetMHCIIpan-4.0: improved predictions of MHC antigen presentation by concurrent motif deconvolution and integration of MS MHC eluted ligand data. Nucleic Acids Res. 48, W449&#x2013;W454 (2020).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR35\" id=\"ref-link-section-d133833025e6132\" rel=\"nofollow noopener\" target=\"_blank\">35<\/a>). HLA\u2013peptide-binding predictions were determined based on percentile ranks for 9\u201311-mer peptides spanning the EBV SNP 85841A&gt;G-encoded Q900R variant in EBNA3B from high-risk 85841G and non-high-risk EBV strains. Peptides with normalized percentile ranks of less than 2% were defined as binders to the respective HLA-A allele\u00a0(Supplementary Tables <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM3\" rel=\"nofollow noopener\" target=\"_blank\">20<\/a> and <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM3\" rel=\"nofollow noopener\" target=\"_blank\">21<\/a>).<\/p>\n<p>AlphaFold3-based structure prediction<\/p>\n<p>The structures of peptide\u2013HLA-A*11:01 complexes for the low-risk peptide VVILENVGQ (85841A encoded) and the high-risk peptide VVILENVSR (85841G encoded) were predicted using the AlphaFold3 public web server<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 94\" title=\"Abramson, J. et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 630, 493&#x2013;500 (2024).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR94\" id=\"ref-link-section-d133833025e6150\" rel=\"nofollow noopener\" target=\"_blank\">94<\/a>. Inputs comprised the HLA-A*11:01 heavy chain, \u03b22M and the EBNA3B peptide sequence, using the HLA-A*11:01\u2013\u03b22M scaffold derived from Protein Data Bank <a href=\"https:\/\/doi.org\/10.2210\/pdb6JOZ\/pdb\" rel=\"nofollow noopener\" target=\"_blank\">6JOZ<\/a> as a structural ref. <a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 95\" title=\"Huan, X., Zhuo, Z., Xiao, Z. &amp; Ren, E. C. Crystal structure of suboptimal viral fragments of Epstein Barr virus Rta peptide-HLA complex that stimulate CD8 T cell response. Sci. Rep. 9, 16660 (2019).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR95\" id=\"ref-link-section-d133833025e6165\" rel=\"nofollow noopener\" target=\"_blank\">95<\/a>. Molecular graphics were generated in PyMOL (v3.1.6.1)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 96\" title=\"Schrodinger, LLC. The PyMOL Molecular Graphics System, version 1.8 (Schrodinger, LLC, 2015).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR96\" id=\"ref-link-section-d133833025e6170\" rel=\"nofollow noopener\" target=\"_blank\">96<\/a>.<\/p>\n<p>Biolayer interferometry assay<\/p>\n<p>Peptides with a purity of more than 95% were synthesized by GenScript Biotech. Biotinylated UV-exchangeable HLA-A*11:01\u2013RVFA-J-SFIK and HLA-A*02:07\u2013LLDSD-J-ERL peptide\u2013MHC monomers were purchased from BetterGen. Biolayer interferometry was performed using an Octet R8 (Sartorius), and data were analysed with Octet Analysis Studio (v12.2) software. After UV irradiation for 20\u2009min on ice to degrade the original A*11:01-bound peptide RVFA-J-SFIK, biotinylated HLA-A*11:01 was loaded onto SSA Biosensors (Sartorius 18-5057) at a concentration of 10\u2009\u03bcg\u2009ml\u22121 for 480\u2009s. Coated sensor tips were dipped into dilution buffer for a 60-s baseline measurement, then into peptide solutions at serially diluted concentrations for a 90-s association phase, and finally into dilution buffer for a 120-s dissociation phase. Peptide concentrations are indicated in each figure. The equilibrium Kd was determined by steady-state analysis of data at equilibrium for each peptide concentration, a method suitable for protein\u2013small-molecule interactions exhibiting fast on and off rates and low signal intensity. The HLA-A*11:01-restricted epitope IVTDFSVIK served as the positive control (Kd\u2009=\u200954.7\u2009\u03bcM), whereas the peptide LLWTLVVLL, which cannot bind to A*11:01, was used as the negative control (Kd\u2009=\u2009242.7\u2009\u03bcM).<\/p>\n<p>HLA-A peptide exchange ELISA<\/p>\n<p>First, 20\u2009\u00b5l diluted peptide (400\u2009\u00b5M in PBS) and 20\u2009\u00b5l HLA-A monomer (0.2\u2009mg\u2009ml\u22121) were added to a microcentrifuge tube. UV-mediated peptide exchange was performed on ice for 30\u2009min under 365-nm UV irradiation. The Flex-T Human Class I Peptide Exchange ELISA Kit (BioLegend) was used to evaluate the efficiency of UV-activated peptide exchange according to the manufacturer\u2019s instructions. DMSO was used as the blank control. For the HLA-A*11:01 monomer, IVTDFSVIK was used as the positive control and CLGGLLTMV as the negative control. For the HLA-A*02:07 monomer, CLGGLLTMV was used as the positive control and IVTDFSVIK as the negative control.<\/p>\n<p>T cell functional assayEBV production<\/p>\n<p>EBV strains B95-8, Akata and M81 were produced by the B95-8 cells, CNE2-Akata cells and CNE2-M81 cells, respectively<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 50\" title=\"Tsai, M. H. et al. Spontaneous lytic replication and epitheliotropism define an Epstein&#x2013;Barr virus strain found in carcinomas. Cell Rep. 5, 458&#x2013;470 (2013).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR50\" id=\"ref-link-section-d133833025e6219\" rel=\"nofollow noopener\" target=\"_blank\">50<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" title=\"Baer, R. et al. DNA sequence and expression of the B95-8 Epstein&#x2013;Barr virus genome. Nature 310, 207&#x2013;211 (1984).\" href=\"#ref-CR97\" id=\"ref-link-section-d133833025e6222\">97<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" title=\"Takada, K. et al. An Epstein&#x2013;Barr virus-producer line Akata: establishment of the cell line and analysis of viral DNA. Virus Genes 5, 147&#x2013;156 (1991).\" href=\"#ref-CR98\" id=\"ref-link-section-d133833025e6222_1\">98<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" title=\"Desgranges, C. et al. In vitro transforming activity of EBV. I-establishment and properties of two EBV strains (M81 and M72) produced by immortalized Callithrix jacchus lymphocytes. Biomedicine 25, 349&#x2013;352 (1976).\" href=\"#ref-CR99\" id=\"ref-link-section-d133833025e6222_2\">99<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 100\" title=\"Zhang, X. et al. Protective anti-gB neutralizing antibodies targeting two vulnerable sites for EBV-cell membrane fusion. Proc. Natl Acad. Sci. USA 119, e2202371119 (2022).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR100\" id=\"ref-link-section-d133833025e6225\" rel=\"nofollow noopener\" target=\"_blank\">100<\/a>. In brief, B95-8 cells were resuspended at a density of 2\u2009\u00d7\u2009105 cells per millilitre in RPMI 1640 medium with low-serum condition (2% fetal bovine serum (FBS)), 100\u2009U\u2009ml\u22121 penicillin and 100\u2009\u00b5g\u2009ml\u22121 streptomycin to trigger the EBV lytic cycle for 2 weeks. To induce CNE2-Akata and CNE2-M81 cells, 20\u2009ng\u2009ml\u22121 12-O-tetradecanoylphorbol 13-acetate (TPA; Beyotime) and 2.5\u2009mM sodium butyrate (NaB; Sigma-Aldrich) were added in RPMI 1640 medium with 10% FBS, 100\u2009U\u2009ml\u22121 penicillin and 100\u2009\u00b5g\u2009ml\u22121 streptomycin for 12\u2009h. Then, the medium was replaced with fresh complete medium, and cells were cultured for 3 days. Cell supernatants were collected and filtered by 0.45-\u00b5m membrane filter (Millipore). EBV was concentrated by centrifugation at 50,000g for 2.5\u2009h and resuspended in RPMI 1640 medium. Virus stocks were stored at \u221280\u2009\u00b0C until use.<\/p>\n<p>Cell line construction<\/p>\n<p>COS-7 cell lines, each overexpressing a single HLA\u2013\u03b22M complex (A*11:01, A*02:07 or A*02:01) and luciferase, were gifted by the Li laboratory<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 36\" title=\"Zhang, S. et al. Immunosequencing identifies signatures of T cell responses for early detection of nasopharyngeal carcinoma. Cancer Cell 43, 1423&#x2013;1441.e10 (2025).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR36\" id=\"ref-link-section-d133833025e6255\" rel=\"nofollow noopener\" target=\"_blank\">36<\/a>. In addition, expression plasmids encoding EBV EBNA3B haplotypes from the high-risk 85841G, high-risk 85841A and low-risk strains were individually transiently transfected into the HLA-A*11:01 and luciferase co-expressing COS-7 cell line using polyethylenimine (PEI; Polysciences) at a DNA:PEI ratio of 1:3, followed by incubation for 24\u2009h.<\/p>\n<p>To establish EBV-infected LCLs, PBMCs were resuspended in B95-8\u2013EBV-containing, Akata\u2013EBV-containing or M81\u2013EBV-containing solutions at a density of 5\u2009\u00d7\u2009105 cells per millilitre, respectively<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 101\" title=\"Nagy, N. Establishment of EBV-infected lymphoblastoid cell lines. Methods Mol. Biol. 1532, 57&#x2013;64 (2017).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR101\" id=\"ref-link-section-d133833025e6264\" rel=\"nofollow noopener\" target=\"_blank\">101<\/a>. After 12\u2009h, cells were centrifuged and cultured at 48-well plates in RPMI 1640 medium with 10% FBS, 1% (v\/v) GlutaMax (Gibco), 1\u2009mM sodium pyruvate (Gibco), 2\u2009\u00b5g\u2009ml\u22121 cyclosporin A (CsA; Yeasen), 100\u2009U\u2009ml\u22121 penicillin and 100\u2009\u00b5g\u2009ml\u22121 streptomycin. Cell culture medium was replaced weekly (50% volume) with fresh complete medium containing 2\u2009\u00b5g\u2009ml\u22121 CsA. After approximately 4\u20136 weeks, the LCLs were stable and proliferated continuously, and were used for subsequent experiments. Successful establishment of LCLs was confirmed by EBER fluorescence in situ hybridization (EBER-FISH) and flow cytometric analysis of B cell markers.<\/p>\n<p>Peptide-specific T cell expansion<\/p>\n<p>Peptide-specific T cells were generated as previously described<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 102\" title=\"Grant, E. J. &amp; Gras, S. Protocol for generation of human peptide-specific primary CD8+ T cell lines. STAR Protoc. 3, 101590 (2022).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR102\" id=\"ref-link-section-d133833025e6285\" rel=\"nofollow noopener\" target=\"_blank\">102<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 103\" title=\"Cimen Bozkus, C., Blazquez, A. B., Enokida, T. &amp; Bhardwaj, N. A T-cell-based immunogenicity protocol for evaluating human antigen-specific responses. STAR Protoc. 2, 100758 (2021).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR103\" id=\"ref-link-section-d133833025e6288\" rel=\"nofollow noopener\" target=\"_blank\">103<\/a>. In brief, PBMCs (1\u2009\u00d7\u2009106 cells) were cultured in 24-well plates containing complete RPMI 1640 medium, consisting of RPMI 1640 medium supplemented with 10% FBS, 100\u2009U\u2009ml\u22121 penicillin, 100\u2009\u00b5g\u2009ml\u22121 streptomycin, 10\u2009mM HEPES (Gibco), 1\u2009mM sodium pyruvate (Gibco), 1% (v\/v) non-essential amino acids (Gibco), 1% (v\/v) GlutaMax (Gibco) and 50\u2009\u00b5M \u03b2-mercaptoethanol (Sigma-Aldrich). On days 1 and 5, PBMCs (5\u2009\u00d7\u2009105 cells) were incubated with single peptide (10\u2009\u00b5M) or a peptide pool (2\u2009\u00b5M per peptide) for 2\u2009h at 37\u2009\u00b0C in 5% CO2. Peptide-pulsed PBMCs were washed once and then mixed with the autologous PBMC cultures. After 3\u2009days of cell culture, cultures with 10\u2009U\u2009ml\u22121 recombinant human IL-2 (PeproTech), 10\u2009ng\u2009ml\u22121 recombinant human IL-7 (Bio-Techne) and 10\u2009ng\u2009ml\u22121 recombinant human IL-15 (PeproTech) were added, and half of the medium was replaced every 2\u2009days thereafter. On day 13, expanded T cells were washed and rested overnight in cytokine-free medium.<\/p>\n<p>T cell activation assay (intracellular cytokine staining)<\/p>\n<p>HLA-A-expressing COS-7 cell lines (used as APCs) were pulsed with peptides in 96-well U-bottom plates and incubated for 2\u2009h at 37\u2009\u00b0C. After incubation, cells were washed twice and then resuspended in complete RPMI 1640 medium for subsequent activation and cytotoxicity assays. Peptide-expanded T cells were co-cultured with peptide-pulsed APCs, EBV EBNA3B-transduced APCs or LCLs in complete RPMI 1640 medium supplemented with anti-human CD28 (1\u2009\u00b5g\u2009ml\u22121; CD28.2, BD Biosciences) and anti-human CD49d (1\u2009\u00b5g\u2009ml\u22121; 9F10, BD Biosciences). Co-cultures were set up in 96-well U-bottom plates at an effector-to-target ratio of 1:5 (5\u2009\u00d7\u2009104 effector cells and 2.5\u2009\u00d7\u2009105 target cells per well) and incubated at 37\u2009\u00b0C for 2\u2009h. Brefeldin A (10\u2009\u00b5g\u2009ml\u22121) and monensin (1\u2009\u00b5M) were then added, followed by incubation at 37\u2009\u00b0C for 6\u2009h. Cells were subsequently kept overnight at 4\u2009\u00b0C. Surface staining was performed for 1\u2009h at 4\u2009\u00b0C using the following reagents diluted at 1:100, including Fixable Viability Dye eFluor 506 (eBioscience), APC\/cyanine7 anti-human CD45 (HI30, BioLegend), PE-Cy7 anti-human CD3 (SP34-2, BD Biosciences) and PerCP-Cy5.5 anti-human CD8 (RPA-T8, BD Biosciences). Cells were then washed, fixed and permeabilized for 1\u20135\u2009h, followed by intracellular staining with Alexa Fluor 647 anti-human IFN\u03b3 (BD Biosciences; Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">11a<\/a>). Intracellular cytokine staining was performed using a CytoFLEX LX flow cytometer (Beckman Coulter). Data were analysed using CytExpert (Beckman Coulter) and FlowJo (v10; TreeStar).<\/p>\n<p>T cell cytotoxicity assay<\/p>\n<p>Peptide-expanded T cells were co-cultured with peptide-pulsed APCs, EBV EBNA3B-transduced APCs or LCLs in complete RPMI 1640 medium in 96-well U-bottom plates at an effector-to-target ratio of 5:1 (2.5\u2009\u00d7\u2009104 effector cells and 5\u2009\u00d7\u2009103 target cells per well). Co-cultures were incubated for 24 or 48\u2009h at 37\u2009\u00b0C in 5% CO2. For luciferase-expressing COS-7 APCs, T cell-mediated cytotoxicity was assessed by measuring the luciferase activity of the remaining viable target cells. After co-incubation, plates were centrifuged at 1,000 rpm for 5\u2009min and washed twice to remove dead cells and cellular debris. Cells were then resuspended in culture medium, mixed with an equal volume of Bio-Lite Plus detection reagent (Bio-Lite Plus Luciferase Assay System, Vazyme) and incubated at room temperature for at least 3\u2009min. Luminescence was measured using a multimode microplate reader (Spark 10\u2009M, Tecan). Percent specific lysis was calculated using the following formula: Specific lysis (%)\u2009=\u2009100\u2009\u00d7\u2009(1\u2009\u2013\u2009test luminescence\/maximum luminescence).<\/p>\n<p>T cell-mediated cytotoxicity against LCL targets was assessed by flow cytometric analysis of target cell death. After co-incubation of LCLs and peptide-expanded T cells, cells were harvested and washed twice with PBS and then incubated with BV421 anti-human CD19 (HIB19, BioLegend) antibody for 30\u2009min at 4\u2009\u00b0C. Then, cells were washed with binding buffer (BioLegend) three times and stained with APC Annexin V Apoptosis Detection Kit (BioLegend) together with SYTOX AADvanced (Invitrogen) according to the manufacturers\u2019 instructions (Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">11b<\/a>). LCLs co-cultured without peptide-expanded T cells served as the baseline control. Samples were analysed on a CytoFLEX LX flow cytometer (Beckman Coulter). Percent specific lysis was calculated as Specific lysis (%)\u2009=\u2009100\u2009\u00d7\u2009(1\u2009\u2013\u2009cell survival in test group\/cell survival in control group).<\/p>\n<p>IFN\u03b3 ELISPOT assay<\/p>\n<p>The IFN\u03b3 enzyme-linked immunospot (ELISPOT) assay was conducted following the manufacturer\u2019s instructions (Human IFN\u03b3 ELISPOT Set, BD Biosciences). In brief, ELISPOT plates were coated with the capture antibody (NA\/LE purified anti-human IFN\u03b3) overnight at 4\u2009\u00b0C. After washing once, plates were blocked with complete RPMI 1640 medium for 2\u2009h at room temperature. Peptide-expanded T cells (1\u2009\u00d7\u2009106 cells per millilitre) and single peptide (2\u2009\u00b5M) or peptide pools (1\u2009\u00b5M per peptide) in complete RPMI 1640 medium were plated and incubated at 37\u2009\u00b0C with 5% CO2 for 18\u201322\u2009h. DMSO was used as a negative control. After incubation, the detection antibody (biotinylated anti-human IFN\u03b3) was added and incubated at room temperature for 2\u2009h, followed by incubation with streptavidin\u2013horseradish peroxidase for 1\u2009h at room temperature. The 3-amino-9-ethylcarbazole substrate (AEC Substrate Set, BD Biosciences) was then added to each well for 15\u201345\u2009min, and deionized water was used to stop the substrate reaction. Spots were enumerated using an AID ELISPOT Reader.<\/p>\n<p>Tetramer staining<\/p>\n<p>PBMCs from patients with NPC or healthy controls were stained for 1\u2009h at 4\u2009\u00b0C with a PE-conjugated HLA-A*11:01 tetramer loaded with VVILENVSR (MBL), AVFDRKSDAK (BetterGen) or IVTDFSVIK (BetterGen), and with an APC-conjugated HLA-A*11:01 tetramer loaded with ATAAAAAAK (MBL) as a negative control. Cells were subsequently surface-stained with Fixable Viability Dye eFluor 506 (eBioscience), FITC anti-human CD3 (HIT3a, BioLegend) and PerCP-Cy5.5 anti-human CD8 (RPA-T8, BD Biosciences; Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">11c<\/a>). Flow cytometry was performed using a CytoFLEX LX flow cytometer (Beckman Coulter). Data were analysed using CytExpert (Beckman Coulter) and FlowJo (v10; TreeStar).<\/p>\n<p>EBV population genetic, phylogenetic and selection analysisEBV genome alignment<\/p>\n<p>High-quality EBV WGS data were obtained from 388 cases and 453 controls from southern China, and 113 healthy controls from other areas in China, after EBV genome quality control. In addition, we retrieved raw EBV WGS fastq data for 176 individuals from published studies in the NCBI databases. Applying the same quality control criteria, EBV WGS data from 118 of these individuals were retained and included in subsequent analyses (for details, see Supplementary Table\u2009<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM3\" rel=\"nofollow noopener\" target=\"_blank\">16<\/a> and Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">7<\/a>). Variant calling was performed following GATK best practices workflow (see the section \u2018EBV variant calling\u2019 for details). Subsequently, consensus genome sequences were generated by integrating sample-specific variants into the reference genome, with \u2018N\u2019 indicating a missing value. The proportion of reads supporting the major allele was assessed for each site. If this proportion exceeded 60%, the major allele was assigned as the consensus base. If the supporting read proportion for the major allele was below 60%, this ambiguous site was masked with N to mitigate potential artefacts. A total of 1,072 consensus genome sequences were generated for the following multiple sequence alignment.<\/p>\n<p>In addition, we retrieved 1,130 assembled EBV genomes (more than 100\u2009kb) from the NCBI database (taxon ID: 10376; accessed July 2022), excluding any sequences that overlapped with the 1,072 consensus genomes generated from raw fastq data in this study. As raw sequencing data were unavailable for these public genomes, only the FASTA-format assemblies were used. Metadata, including geographical origin, EBV type and diseases of carriers, were extracted for all sequences (Supplementary Table <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM3\" rel=\"nofollow noopener\" target=\"_blank\">16<\/a>). Together with the 1,072 consensus sequences generated in this study, all 2,202 genomes were included in the subsequent multiple sequence alignment.<\/p>\n<p>Multiple sequence alignment was performed using MAFFT (v7.490)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 104\" title=\"Katoh, K. &amp; Standley, D. M. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 30, 772&#x2013;780 (2013).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR104\" id=\"ref-link-section-d133833025e6403\" rel=\"nofollow noopener\" target=\"_blank\">104<\/a> with the \u2018\u2013keeplength\u2019 parameter to preserve the original length of the reference genome (171,823\u2009bp) and establish homologous alignment. To ensure high alignment quality, we first masked repetitive regions (annotated in <a href=\"https:\/\/www.ncbi.nlm.nih.gov\/nuccore\/NC_007605.1\" rel=\"nofollow noopener\" target=\"_blank\">NC_007605.1<\/a>, 20.7% of the EBV genome) and low-coverage regions defined as more than 50% N characters across all alignments in a 100-bp window. Subsequently, sequences with missing values exceeding 25% were excluded from further analysis. Following these quality control steps, a total of 2,086 EBV genomes were retained for downstream analyses.<\/p>\n<p>Tree construction<\/p>\n<p>EBV has been classified into two major types, type 1 and type 2, which diverged early in evolution and exhibit distinct genomic features, particularly in the EBNA2,\u00a0EBNA3A, EBNA3B and EBNA3C gene regions, with type 1 representing the predominant lineage globally. To account for this deep evolutionary split, we first distinguished type 1 and type 2 strains before downstream analyses. We performed PCA based on genome-wide variation from 2,086 EBV strains. Variants were identified based on the multiple sequence alignment, and variants with high levels of missing data (more than 10%) or a MAF below 5% were removed using VCFtools (v0.1.13)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 105\" title=\"Danecek, P. et al. The variant call format and VCFtools. Bioinformatics 27, 2156&#x2013;2158 (2011).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR105\" id=\"ref-link-section-d133833025e6434\" rel=\"nofollow noopener\" target=\"_blank\">105<\/a>. PCA was subsequently performed with PLINK (v1.9)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 60\" title=\"Chang, C. C. et al. Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience 4, 7 (2015).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR60\" id=\"ref-link-section-d133833025e6439\" rel=\"nofollow noopener\" target=\"_blank\">60<\/a> and identified two genetically distinct EBV clusters. These clusters were primarily differentiated by variation within the EBNA2 and EBNA3 genes, corresponding to the EBV type 1 and type 2 lineages (Supplementary Fig. <a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM1\" rel=\"nofollow noopener\" target=\"_blank\">12<\/a>). Given the clear separation and the global predominance of type 1, subsequent analyses were restricted to this group (n\u2009=\u20091,852).<\/p>\n<p>The maximum likelihood of the phylogenetic relationship was inferred using IQ-TREE 2 (v2.2.0)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 106\" title=\"Minh, B. Q. et al. IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Mol. Biol. Evol. 37, 1530&#x2013;1534 (2020).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR106\" id=\"ref-link-section-d133833025e6458\" rel=\"nofollow noopener\" target=\"_blank\">106<\/a>. The optimal model of nucleotide substitution was selected using the ModelFinder function within IQ-TREE 2, based on the Bayesian Information Criterion<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 107\" title=\"Kalyaanamoorthy, S., Minh, B. Q., Wong, T. K. F., von Haeseler, A. &amp; Jermiin, L. S. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat. Methods 14, 587&#x2013;589 (2017).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR107\" id=\"ref-link-section-d133833025e6462\" rel=\"nofollow noopener\" target=\"_blank\">107<\/a>. The model TVM\u2009+\u2009F\u2009+\u2009I\u2009+\u2009R7 was identified as the best fitting and was used for final tree construction, with statistical support assessed using 1,000 non-parametric bootstrap pseudoreplicates. To evaluate the robustness of phylogenetic inference to recombination, we performed a recombination-masked analysis by excluding the inferred N1-derived recombinant region (approximately 54\u2013130\u2009kb) from the multiple sequence alignment and reconstructing the maximum likelihood tree using the same IQ-TREE 2 workflow.<\/p>\n<p>The phylogeny was rooted using an African-derived EBV strain (KP968262.1), as African lineages are known to occupy basal positions in global EBV trees, consistent with the co-evolutionary history of EBV and its human host originating in Africa. Rooting was performed using the root function in R package ape (v5.8.1)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 108\" title=\"Paradis, E., Claude, J. &amp; Strimmer, K. APE: analyses of phylogenetics and evolution in R language. Bioinformatics 20, 289&#x2013;290 (2004).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR108\" id=\"ref-link-section-d133833025e6469\" rel=\"nofollow noopener\" target=\"_blank\">108<\/a>. All phylogenetic trees were subsequently visualized and annotated using R packages ape (v5.8.1), treeio (v1.30.0), ggtree (v3.14.0) and ggtreeExtra (v1.16.0)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" title=\"Paradis, E., Claude, J. &amp; Strimmer, K. APE: analyses of phylogenetics and evolution in R language. Bioinformatics 20, 289&#x2013;290 (2004).\" href=\"#ref-CR108\" id=\"ref-link-section-d133833025e6473\">108<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" title=\"Yu, G., Lam, T. T., Zhu, H. &amp; Guan, Y. Two methods for mapping and visualizing associated data on phylogeny using ggtree. Mol. Biol. Evol. 35, 3041&#x2013;3043 (2018).\" href=\"#ref-CR109\" id=\"ref-link-section-d133833025e6473_1\">109<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" title=\"Xu, S. et al. ggtreeExtra: compact visualization of richly annotated phylogenetic data. Mol. Biol. Evol. 38, 4039&#x2013;4042 (2021).\" href=\"#ref-CR110\" id=\"ref-link-section-d133833025e6473_2\">110<\/a>,<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 111\" title=\"Wang, L. G. et al. Treeio: an R package for phylogenetic tree input and output with richly annotated and associated data. Mol. Biol. Evol. 37, 599&#x2013;603 (2020).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR111\" id=\"ref-link-section-d133833025e6476\" rel=\"nofollow noopener\" target=\"_blank\">111<\/a>.<\/p>\n<p>Chromosome painting analysis<\/p>\n<p>To investigate the ancestry composition and detect potential admixture signals in EBV strains, we applied a chromosome painting approach using ChromoPainter, embedded within the fineSTRUCTURE (v4.1.0)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 112\" title=\"Lawson, D. J., Hellenthal, G., Myers, S. &amp; Falush, D. Inference of population structure using dense haplotype data. PLoS Genet. 8, e1002453 (2012).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR112\" id=\"ref-link-section-d133833025e6488\" rel=\"nofollow noopener\" target=\"_blank\">112<\/a>. ChromoPainter uses a hidden Markov model to reconstruct each recipient haplotype as a mosaic of genomic segments copied from the donor haplotypes. A total of 132 EBV genomes from northern China (N1) and 116 from southern China (S1) were designated as donors to paint 643 recipient genomes (C1 and X1).<\/p>\n<p>As ChromoPainter requires phased haplotypes, we first converted filtered VCF files into ChromoPainter-compatible.phase format using PLINK (v1.9)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 60\" title=\"Chang, C. C. et al. Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience 4, 7 (2015).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR60\" id=\"ref-link-section-d133833025e6495\" rel=\"nofollow noopener\" target=\"_blank\">60<\/a> and a companion script supplied by ChromoPainter (plink2chromopainter). ChromoPainter was first run in estimation mode (-a 0 0) using all samples to infer the effective population size (Ne) and mutation rate (\u03bc). In the subsequent painting step, these estimated parameters were applied, with the number of expectation-maximization iterations set to 10, and the -k parameter set to 20, defining the expected number of chunks copied from donors.<\/p>\n<p>Genomic similarity and recombination analysis<\/p>\n<p>Genetic similarity between consensus genome sequence of 85841G-carrying high-risk strains and other strains on the phylogeny was accessed using a sliding window approach (1,000-bp window size and 100-bp step size). To detect recombination, we generated consensus genome sequences for each focal clade (for example, S1, N1, X1 and C1) using EMBOSS (v6.6.0.0)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 113\" title=\"Rice, P., Longden, I. &amp; Bleasby, A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 16, 276&#x2013;277 (2000).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR113\" id=\"ref-link-section-d133833025e6507\" rel=\"nofollow noopener\" target=\"_blank\">113<\/a>, and conducted recombination analysis on these consensus sequences using RDP5 (ref. <a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 114\" title=\"Martin, D. P. et al. RDP5: a computer program for analyzing recombination in, and removing signals of recombination from, nucleotide sequence datasets. Virus Evol. 7, veaa087 (2021).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR114\" id=\"ref-link-section-d133833025e6511\" rel=\"nofollow noopener\" target=\"_blank\">114<\/a>). Genetic differentiation between clades was evaluated by calculating the fixation index (FST, Weir and Cockerham\u2019s method), implemented in VCFtools (v0.1.13)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 105\" title=\"Danecek, P. et al. The variant call format and VCFtools. Bioinformatics 27, 2156&#x2013;2158 (2011).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR105\" id=\"ref-link-section-d133833025e6515\" rel=\"nofollow noopener\" target=\"_blank\">105<\/a>, with the same window parameters.<\/p>\n<p>Extended haplotype homozygosity test<\/p>\n<p>In healthy individuals from southern China, extended haplotype homozygosity spanning EBV variants (that is, SNP 85841, SNP 84414, SNP 84462, SNP 7048 and SNP 163364) was estimated using the R package rehh (v3.2.2)<a data-track=\"click\" data-track-action=\"reference anchor\" data-track-label=\"link\" data-test=\"citation-ref\" aria-label=\"Reference 115\" title=\"Gautier, M. &amp; Vitalis, R. rehh: An R package to detect footprints of selection in genome-wide SNP data from haplotype structure. Bioinformatics 28, 1176&#x2013;1177 (2012).\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#ref-CR115\" id=\"ref-link-section-d133833025e6528\" rel=\"nofollow noopener\" target=\"_blank\">115<\/a>.<\/p>\n<p>Reporting summary<\/p>\n<p>Further information on research design is available in the\u00a0<a data-track=\"click\" data-track-label=\"link\" data-track-action=\"supplementary material anchor\" href=\"http:\/\/www.nature.com\/articles\/s41586-026-10416-8#MOESM2\" rel=\"nofollow noopener\" target=\"_blank\">Nature Portfolio Reporting Summary<\/a> linked to this article.<\/p>\n","protected":false},"excerpt":{"rendered":"Study participants Participants from southern China were enrolled through two independent recruitments (sample sets 1 and 2). Participants&hellip;\n","protected":false},"author":2,"featured_media":587299,"comment_status":"","ping_status":"","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[34],"tags":[70007,91146,34411,108637,97,256877,1159,1160,79],"class_list":["post-587298","post","type-post","status-publish","format-standard","has-post-thumbnail","category-health","tag-evolutionary-genetics","tag-genetic-interaction","tag-genome-wide-association-studies","tag-head-and-neck-cancer","tag-health","tag-herpes-virus","tag-humanities-and-social-sciences","tag-multidisciplinary","tag-science"],"_links":{"self":[{"href":"https:\/\/www.newsbeep.com\/us\/wp-json\/wp\/v2\/posts\/587298","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/www.newsbeep.com\/us\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/www.newsbeep.com\/us\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/www.newsbeep.com\/us\/wp-json\/wp\/v2\/users\/2"}],"replies":[{"embeddable":true,"href":"https:\/\/www.newsbeep.com\/us\/wp-json\/wp\/v2\/comments?post=587298"}],"version-history":[{"count":0,"href":"https:\/\/www.newsbeep.com\/us\/wp-json\/wp\/v2\/posts\/587298\/revisions"}],"wp:featuredmedia":[{"embeddable":true,"href":"https:\/\/www.newsbeep.com\/us\/wp-json\/wp\/v2\/media\/587299"}],"wp:attachment":[{"href":"https:\/\/www.newsbeep.com\/us\/wp-json\/wp\/v2\/media?parent=587298"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/www.newsbeep.com\/us\/wp-json\/wp\/v2\/categories?post=587298"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/www.newsbeep.com\/us\/wp-json\/wp\/v2\/tags?post=587298"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}